FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640107_at:

>probe:Drosophila_2:1640107_at:565:235; Interrogation_Position=1284; Antisense; AATCCCAAGACTACTACTATTCCAT
>probe:Drosophila_2:1640107_at:270:29; Interrogation_Position=1309; Antisense; ATACTGTTTCAGCTATCCTATGTGA
>probe:Drosophila_2:1640107_at:11:279; Interrogation_Position=1321; Antisense; CTATCCTATGTGATCTTCGCCTAAA
>probe:Drosophila_2:1640107_at:479:163; Interrogation_Position=1344; Antisense; AAATTTCAATTTCCCTCATCTCTAC
>probe:Drosophila_2:1640107_at:710:279; Interrogation_Position=1358; Antisense; CTCATCTCTACGTTACTCTACTTAA
>probe:Drosophila_2:1640107_at:273:283; Interrogation_Position=1411; Antisense; CTGTCTATAAGGAAACCCACTCTTT
>probe:Drosophila_2:1640107_at:330:255; Interrogation_Position=1462; Antisense; CAAACTTGAATCTTTTCCGTTCTCT
>probe:Drosophila_2:1640107_at:176:721; Interrogation_Position=1476; Antisense; TTCCGTTCTCTTTTCTTGATTTCTT
>probe:Drosophila_2:1640107_at:157:475; Interrogation_Position=1554; Antisense; GTTACGCTACAGTTTATTATTCCTA
>probe:Drosophila_2:1640107_at:203:115; Interrogation_Position=1595; Antisense; AGCATTTCAATCCTGTAATCTTGTA
>probe:Drosophila_2:1640107_at:101:237; Interrogation_Position=1611; Antisense; AATCTTGTATTTCACTTCTACCTCA
>probe:Drosophila_2:1640107_at:25:715; Interrogation_Position=1655; Antisense; TTCTATACATTCTATCTTCCTCATA
>probe:Drosophila_2:1640107_at:115:31; Interrogation_Position=1752; Antisense; ATAAACATCTTGACTTGCCTGCAAA
>probe:Drosophila_2:1640107_at:346:653; Interrogation_Position=1822; Antisense; TCAACCGACTGTAAACCCATGACAC

Paste this into a BLAST search page for me
AATCCCAAGACTACTACTATTCCATATACTGTTTCAGCTATCCTATGTGACTATCCTATGTGATCTTCGCCTAAAAAATTTCAATTTCCCTCATCTCTACCTCATCTCTACGTTACTCTACTTAACTGTCTATAAGGAAACCCACTCTTTCAAACTTGAATCTTTTCCGTTCTCTTTCCGTTCTCTTTTCTTGATTTCTTGTTACGCTACAGTTTATTATTCCTAAGCATTTCAATCCTGTAATCTTGTAAATCTTGTATTTCACTTCTACCTCATTCTATACATTCTATCTTCCTCATAATAAACATCTTGACTTGCCTGCAAATCAACCGACTGTAAACCCATGACAC

Full Affymetrix probeset data:

Annotations for 1640107_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720