FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640108_at:

>probe:Drosophila_2:1640108_at:432:359; Interrogation_Position=1077; Antisense; GCAACGCCTCGATGAACACAAAAAG
>probe:Drosophila_2:1640108_at:374:119; Interrogation_Position=1103; Antisense; AGCTGGCCAAGATGTTGGGCCTGCA
>probe:Drosophila_2:1640108_at:568:349; Interrogation_Position=1125; Antisense; GCAGAAGGAGATCCACGACCACCTC
>probe:Drosophila_2:1640108_at:562:413; Interrogation_Position=1162; Antisense; GACCTGACCCGATTGCCGGATGTGA
>probe:Drosophila_2:1640108_at:590:133; Interrogation_Position=1168; Antisense; ACCCGATTGCCGGATGTGACTGGCG
>probe:Drosophila_2:1640108_at:45:63; Interrogation_Position=1181; Antisense; ATGTGACTGGCGGACTTGCGCCCCT
>probe:Drosophila_2:1640108_at:69:583; Interrogation_Position=1215; Antisense; TGGCGATCTCTTCAACGCCCTGCAT
>probe:Drosophila_2:1640108_at:384:649; Interrogation_Position=1226; Antisense; TCAACGCCCTGCATTGAAGGAAACG
>probe:Drosophila_2:1640108_at:88:295; Interrogation_Position=1249; Antisense; CGAAGGAGTCACTTTAAGATTACAT
>probe:Drosophila_2:1640108_at:585:685; Interrogation_Position=1275; Antisense; TATATTTGCAATTGTCCCCCTAATC
>probe:Drosophila_2:1640108_at:546:157; Interrogation_Position=1311; Antisense; ACAAATCCCCTGACTGTAATCCAAG
>probe:Drosophila_2:1640108_at:50:407; Interrogation_Position=1322; Antisense; GACTGTAATCCAAGCACACACAAGA
>probe:Drosophila_2:1640108_at:584:111; Interrogation_Position=1334; Antisense; AGCACACACAAGAATGACGATTTCA
>probe:Drosophila_2:1640108_at:348:409; Interrogation_Position=1349; Antisense; GACGATTTCAATATAGCATCTAATT

Paste this into a BLAST search page for me
GCAACGCCTCGATGAACACAAAAAGAGCTGGCCAAGATGTTGGGCCTGCAGCAGAAGGAGATCCACGACCACCTCGACCTGACCCGATTGCCGGATGTGAACCCGATTGCCGGATGTGACTGGCGATGTGACTGGCGGACTTGCGCCCCTTGGCGATCTCTTCAACGCCCTGCATTCAACGCCCTGCATTGAAGGAAACGCGAAGGAGTCACTTTAAGATTACATTATATTTGCAATTGTCCCCCTAATCACAAATCCCCTGACTGTAATCCAAGGACTGTAATCCAAGCACACACAAGAAGCACACACAAGAATGACGATTTCAGACGATTTCAATATAGCATCTAATT

Full Affymetrix probeset data:

Annotations for 1640108_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720