FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640109_at:

>probe:Drosophila_2:1640109_at:33:409; Interrogation_Position=1175; Antisense; GACGGAGGCCCAGTATCATGGCAAA
>probe:Drosophila_2:1640109_at:338:579; Interrogation_Position=1207; Antisense; TGGCCCTACCAGTTTTCGGTGACCA
>probe:Drosophila_2:1640109_at:339:305; Interrogation_Position=1234; Antisense; CCTCCAATGCCGATGTCATGGTGAT
>probe:Drosophila_2:1640109_at:481:209; Interrogation_Position=1275; Antisense; AAGCAAAGCATCCTTACCCTGGAGG
>probe:Drosophila_2:1640109_at:630:437; Interrogation_Position=1299; Antisense; GAGGACAGCTTCCTGCAGGGAATTC
>probe:Drosophila_2:1640109_at:72:33; Interrogation_Position=1336; Antisense; ATAATCCGAAGTATGCCACTGCCGT
>probe:Drosophila_2:1640109_at:56:473; Interrogation_Position=1367; Antisense; GTTCTCAACTCTCTATCGGGATCGT
>probe:Drosophila_2:1640109_at:450:451; Interrogation_Position=1386; Antisense; GATCGTCCTCTAAGTCCTCGTGAGA
>probe:Drosophila_2:1640109_at:306:511; Interrogation_Position=1405; Antisense; GTGAGACCCTGATCTACTGGGTGGA
>probe:Drosophila_2:1640109_at:441:63; Interrogation_Position=1432; Antisense; ATGTGATTCGATACCACGGAGCTCC
>probe:Drosophila_2:1640109_at:33:311; Interrogation_Position=1497; Antisense; GCCAATAACCTGGACGTATATGCTG
>probe:Drosophila_2:1640109_at:335:481; Interrogation_Position=1512; Antisense; GTATATGCTGTGATCCTCGGAACGA
>probe:Drosophila_2:1640109_at:198:139; Interrogation_Position=1533; Antisense; ACGATTGTTGCTCTCTGCTTTATTA
>probe:Drosophila_2:1640109_at:611:311; Interrogation_Position=1670; Antisense; GCCACCTCCTGCCAAATAGTTTTTT

Paste this into a BLAST search page for me
GACGGAGGCCCAGTATCATGGCAAATGGCCCTACCAGTTTTCGGTGACCACCTCCAATGCCGATGTCATGGTGATAAGCAAAGCATCCTTACCCTGGAGGGAGGACAGCTTCCTGCAGGGAATTCATAATCCGAAGTATGCCACTGCCGTGTTCTCAACTCTCTATCGGGATCGTGATCGTCCTCTAAGTCCTCGTGAGAGTGAGACCCTGATCTACTGGGTGGAATGTGATTCGATACCACGGAGCTCCGCCAATAACCTGGACGTATATGCTGGTATATGCTGTGATCCTCGGAACGAACGATTGTTGCTCTCTGCTTTATTAGCCACCTCCTGCCAAATAGTTTTTT

Full Affymetrix probeset data:

Annotations for 1640109_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720