Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640110_at:

>probe:Drosophila_2:1640110_at:312:199; Interrogation_Position=10495; Antisense; AACGAGACGTACCAGAAGCACGGCT
>probe:Drosophila_2:1640110_at:501:593; Interrogation_Position=10526; Antisense; TGGGCGATTCGCACAAGAAGCTCGT
>probe:Drosophila_2:1640110_at:422:251; Interrogation_Position=10539; Antisense; CAAGAAGCTCGTGAAGCTGCTGGCC
>probe:Drosophila_2:1640110_at:485:581; Interrogation_Position=10559; Antisense; TGGCCATCGCCAAGGGCAGCAAAAA
>probe:Drosophila_2:1640110_at:689:397; Interrogation_Position=10588; Antisense; GACAACTGCGGTGTCAAGCGGCGCA
>probe:Drosophila_2:1640110_at:373:553; Interrogation_Position=10641; Antisense; GGAGCAGCGTCACCAGACGTAGCAA
>probe:Drosophila_2:1640110_at:95:103; Interrogation_Position=10655; Antisense; AGACGTAGCAACAGCTGGCGTAGGA
>probe:Drosophila_2:1640110_at:259:583; Interrogation_Position=10670; Antisense; TGGCGTAGGAGCACAGCACAGTCTC
>probe:Drosophila_2:1640110_at:576:217; Interrogation_Position=10707; Antisense; AAGTCATAGCCATAGGCCTCGAGGG
>probe:Drosophila_2:1640110_at:225:43; Interrogation_Position=10770; Antisense; ATCGATCACATACGTACTGCCATTG
>probe:Drosophila_2:1640110_at:40:489; Interrogation_Position=10783; Antisense; GTACTGCCATTGTGTCATCGTTAAT
>probe:Drosophila_2:1640110_at:227:473; Interrogation_Position=10802; Antisense; GTTAATCGTTAACGCCGGCGCCAGG
>probe:Drosophila_2:1640110_at:65:529; Interrogation_Position=10892; Antisense; GGGAGCACCCACTTGGCAGAGGCCA
>probe:Drosophila_2:1640110_at:227:297; Interrogation_Position=10928; Antisense; CGCACCCATTAACCGTATGCGGAGT

Paste this into a BLAST search page for me
AACGAGACGTACCAGAAGCACGGCTTGGGCGATTCGCACAAGAAGCTCGTCAAGAAGCTCGTGAAGCTGCTGGCCTGGCCATCGCCAAGGGCAGCAAAAAGACAACTGCGGTGTCAAGCGGCGCAGGAGCAGCGTCACCAGACGTAGCAAAGACGTAGCAACAGCTGGCGTAGGATGGCGTAGGAGCACAGCACAGTCTCAAGTCATAGCCATAGGCCTCGAGGGATCGATCACATACGTACTGCCATTGGTACTGCCATTGTGTCATCGTTAATGTTAATCGTTAACGCCGGCGCCAGGGGGAGCACCCACTTGGCAGAGGCCACGCACCCATTAACCGTATGCGGAGT

Full Affymetrix probeset data:

Annotations for 1640110_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime