FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640112_at:

>probe:Drosophila_2:1640112_at:137:339; Interrogation_Position=169; Antisense; GCTCTGGAACTTCTGGATGCCACTC
>probe:Drosophila_2:1640112_at:268:93; Interrogation_Position=17; Antisense; AGTTCTCTCAGAGTCGTCGAGCGAG
>probe:Drosophila_2:1640112_at:534:441; Interrogation_Position=214; Antisense; GATGGTCCCAGCTACAAGGCAATCA
>probe:Drosophila_2:1640112_at:624:565; Interrogation_Position=231; Antisense; GGCAATCAATGTGACCTCTGTGACG
>probe:Drosophila_2:1640112_at:252:561; Interrogation_Position=294; Antisense; GGAACTTGACAATGGATCCGACAAA
>probe:Drosophila_2:1640112_at:456:267; Interrogation_Position=322; Antisense; CAGTGCACCGTGAAGATCTGGACTC
>probe:Drosophila_2:1640112_at:590:97; Interrogation_Position=335; Antisense; AGATCTGGACTCAGCCATGGCTCAA
>probe:Drosophila_2:1640112_at:485:219; Interrogation_Position=385; Antisense; AAGTGCTCTGGTGACGATGGCGAAC
>probe:Drosophila_2:1640112_at:32:67; Interrogation_Position=401; Antisense; ATGGCGAACTGGACCGCACCTGGTA
>probe:Drosophila_2:1640112_at:143:133; Interrogation_Position=413; Antisense; ACCGCACCTGGTAGAAGATTCTTCG
>probe:Drosophila_2:1640112_at:329:461; Interrogation_Position=429; Antisense; GATTCTTCGTGAGAATTGCCCTGAA
>probe:Drosophila_2:1640112_at:164:515; Interrogation_Position=66; Antisense; GTGTATTTTGGGTCTGGTTCTCGTC
>probe:Drosophila_2:1640112_at:15:589; Interrogation_Position=80; Antisense; TGGTTCTCGTCAGCTTGATTGCCAC
>probe:Drosophila_2:1640112_at:523:463; Interrogation_Position=96; Antisense; GATTGCCACCCAAGCAGCCGATGAG

Paste this into a BLAST search page for me
GCTCTGGAACTTCTGGATGCCACTCAGTTCTCTCAGAGTCGTCGAGCGAGGATGGTCCCAGCTACAAGGCAATCAGGCAATCAATGTGACCTCTGTGACGGGAACTTGACAATGGATCCGACAAACAGTGCACCGTGAAGATCTGGACTCAGATCTGGACTCAGCCATGGCTCAAAAGTGCTCTGGTGACGATGGCGAACATGGCGAACTGGACCGCACCTGGTAACCGCACCTGGTAGAAGATTCTTCGGATTCTTCGTGAGAATTGCCCTGAAGTGTATTTTGGGTCTGGTTCTCGTCTGGTTCTCGTCAGCTTGATTGCCACGATTGCCACCCAAGCAGCCGATGAG

Full Affymetrix probeset data:

Annotations for 1640112_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720