FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640113_at:

>probe:Drosophila_2:1640113_at:237:83; Interrogation_Position=2132; Antisense; AGTGGAGATTAACCCCAGACTGCTG
>probe:Drosophila_2:1640113_at:662:593; Interrogation_Position=2155; Antisense; TGGGCACCTCGTTAGCTAGCAAGAT
>probe:Drosophila_2:1640113_at:268:439; Interrogation_Position=2251; Antisense; GAGGCATCAAGCGAGCGTTCCAAAA
>probe:Drosophila_2:1640113_at:246:489; Interrogation_Position=2277; Antisense; GTACTGCTTATTCCGAAGTGCGATT
>probe:Drosophila_2:1640113_at:662:147; Interrogation_Position=2307; Antisense; ACTAGCTTCCTGCTGTGGCTGGAAC
>probe:Drosophila_2:1640113_at:217:607; Interrogation_Position=2332; Antisense; TGATGACCGAGAACGCGCCAGATGA
>probe:Drosophila_2:1640113_at:157:225; Interrogation_Position=2361; Antisense; AAGGAGTACGCCTACTCGGCACTGG
>probe:Drosophila_2:1640113_at:344:713; Interrogation_Position=2395; Antisense; TTCAGGCGTACAACTCCGGCGACAT
>probe:Drosophila_2:1640113_at:42:77; Interrogation_Position=2434; Antisense; AGGAGACCTTGAACATCGACCGTAA
>probe:Drosophila_2:1640113_at:9:569; Interrogation_Position=2477; Antisense; GGCATTGGATCCGAACGAGTTCCTT
>probe:Drosophila_2:1640113_at:84:429; Interrogation_Position=2493; Antisense; GAGTTCCTTGAATATTTCCTGAGCA
>probe:Drosophila_2:1640113_at:399:421; Interrogation_Position=2513; Antisense; GAGCAAGAATGAGCCTCCCATTTTC
>probe:Drosophila_2:1640113_at:525:633; Interrogation_Position=2528; Antisense; TCCCATTTTCCCTCCAGATGAGAAG
>probe:Drosophila_2:1640113_at:592:473; Interrogation_Position=2564; Antisense; GTTCAATAAATGGTTCGGCAGCTCA

Paste this into a BLAST search page for me
AGTGGAGATTAACCCCAGACTGCTGTGGGCACCTCGTTAGCTAGCAAGATGAGGCATCAAGCGAGCGTTCCAAAAGTACTGCTTATTCCGAAGTGCGATTACTAGCTTCCTGCTGTGGCTGGAACTGATGACCGAGAACGCGCCAGATGAAAGGAGTACGCCTACTCGGCACTGGTTCAGGCGTACAACTCCGGCGACATAGGAGACCTTGAACATCGACCGTAAGGCATTGGATCCGAACGAGTTCCTTGAGTTCCTTGAATATTTCCTGAGCAGAGCAAGAATGAGCCTCCCATTTTCTCCCATTTTCCCTCCAGATGAGAAGGTTCAATAAATGGTTCGGCAGCTCA

Full Affymetrix probeset data:

Annotations for 1640113_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720