FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640115_at:

>probe:Drosophila_2:1640115_at:450:655; Interrogation_Position=1167; Antisense; TAAGTTGAAGGCTACCGGCACCTTG
>probe:Drosophila_2:1640115_at:427:289; Interrogation_Position=1182; Antisense; CGGCACCTTGGACGATTTACCTTAG
>probe:Drosophila_2:1640115_at:459:729; Interrogation_Position=1240; Antisense; TTGTGCTGCAAGCTACAATCTCAGT
>probe:Drosophila_2:1640115_at:331:497; Interrogation_Position=1263; Antisense; GTCATTTTTGCTTTATCCATCATGG
>probe:Drosophila_2:1640115_at:711:279; Interrogation_Position=1314; Antisense; CTCCTTAGCCACTTTATCCTTTAAG
>probe:Drosophila_2:1640115_at:92:277; Interrogation_Position=1371; Antisense; CTTTCCGGCTTTGAGTGCAGACACA
>probe:Drosophila_2:1640115_at:725:157; Interrogation_Position=1391; Antisense; ACACAAACAGTTGCACCTTTTCATC
>probe:Drosophila_2:1640115_at:302:37; Interrogation_Position=1420; Antisense; ATCTCTTGGAGATCCGAGTTTTCCG
>probe:Drosophila_2:1640115_at:119:93; Interrogation_Position=1436; Antisense; AGTTTTCCGCTTTTATCACCATACA
>probe:Drosophila_2:1640115_at:333:71; Interrogation_Position=1468; Antisense; AGGCGCAGCAACTTCAAGGCGTTCT
>probe:Drosophila_2:1640115_at:88:645; Interrogation_Position=1537; Antisense; TCTTCGAACTCATTGGCGTCGGGAT
>probe:Drosophila_2:1640115_at:555:301; Interrogation_Position=1569; Antisense; CCCCGTGTAGTTGTCAATGTGCTGT
>probe:Drosophila_2:1640115_at:601:369; Interrogation_Position=1626; Antisense; GAAGGCCTCCTTGTGATAGAAGTAC
>probe:Drosophila_2:1640115_at:120:27; Interrogation_Position=1641; Antisense; ATAGAAGTACTTCAGGCGCTGCAAA

Paste this into a BLAST search page for me
TAAGTTGAAGGCTACCGGCACCTTGCGGCACCTTGGACGATTTACCTTAGTTGTGCTGCAAGCTACAATCTCAGTGTCATTTTTGCTTTATCCATCATGGCTCCTTAGCCACTTTATCCTTTAAGCTTTCCGGCTTTGAGTGCAGACACAACACAAACAGTTGCACCTTTTCATCATCTCTTGGAGATCCGAGTTTTCCGAGTTTTCCGCTTTTATCACCATACAAGGCGCAGCAACTTCAAGGCGTTCTTCTTCGAACTCATTGGCGTCGGGATCCCCGTGTAGTTGTCAATGTGCTGTGAAGGCCTCCTTGTGATAGAAGTACATAGAAGTACTTCAGGCGCTGCAAA

Full Affymetrix probeset data:

Annotations for 1640115_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720