FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640118_at:

>probe:Drosophila_2:1640118_at:392:423; Interrogation_Position=310; Antisense; GAGAAGCTGCTTGAGGGCACCACAT
>probe:Drosophila_2:1640118_at:245:519; Interrogation_Position=340; Antisense; GTGGATCGATATTCGTTCTCTGGCG
>probe:Drosophila_2:1640118_at:221:471; Interrogation_Position=354; Antisense; GTTCTCTGGCGTGGCATATAGCGCA
>probe:Drosophila_2:1640118_at:574:693; Interrogation_Position=394; Antisense; TTTGATTGGTGCTATGCTCCGGAAA
>probe:Drosophila_2:1640118_at:696:523; Interrogation_Position=421; Antisense; GGGCTCATAAAACCAGATGCTGTAT
>probe:Drosophila_2:1640118_at:647:691; Interrogation_Position=445; Antisense; TTTTACCTAAGAGCACCACCAAACG
>probe:Drosophila_2:1640118_at:682:107; Interrogation_Position=516; Antisense; AGAATTCCAAGGTCGTGTGGCCGAA
>probe:Drosophila_2:1640118_at:271:521; Interrogation_Position=532; Antisense; GTGGCCGAAGTATTCAACCGCATTT
>probe:Drosophila_2:1640118_at:62:251; Interrogation_Position=561; Antisense; CAAGGAGGGCAGCTATTTTCACCAG
>probe:Drosophila_2:1640118_at:37:701; Interrogation_Position=576; Antisense; TTTTCACCAGTTCGATGCCAGACAG
>probe:Drosophila_2:1640118_at:680:435; Interrogation_Position=607; Antisense; GAGGATTTACATGCCCAGATAGCGA
>probe:Drosophila_2:1640118_at:90:413; Interrogation_Position=668; Antisense; GACCTCTGGACACGTTATCGTAGCA
>probe:Drosophila_2:1640118_at:8:245; Interrogation_Position=789; Antisense; AATTTACGATAAAGCCGCAGGCAAT
>probe:Drosophila_2:1640118_at:600:361; Interrogation_Position=809; Antisense; GCAATAAATCCTAGCATCGGGCGAT

Paste this into a BLAST search page for me
GAGAAGCTGCTTGAGGGCACCACATGTGGATCGATATTCGTTCTCTGGCGGTTCTCTGGCGTGGCATATAGCGCATTTGATTGGTGCTATGCTCCGGAAAGGGCTCATAAAACCAGATGCTGTATTTTTACCTAAGAGCACCACCAAACGAGAATTCCAAGGTCGTGTGGCCGAAGTGGCCGAAGTATTCAACCGCATTTCAAGGAGGGCAGCTATTTTCACCAGTTTTCACCAGTTCGATGCCAGACAGGAGGATTTACATGCCCAGATAGCGAGACCTCTGGACACGTTATCGTAGCAAATTTACGATAAAGCCGCAGGCAATGCAATAAATCCTAGCATCGGGCGAT

Full Affymetrix probeset data:

Annotations for 1640118_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720