Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640122_at:

>probe:Drosophila_2:1640122_at:194:517; Interrogation_Position=380; Antisense; GTGGACTAAGACCAAACCGCCGGAT
>probe:Drosophila_2:1640122_at:293:683; Interrogation_Position=423; Antisense; TATGAGCTGCAATATGCCCGCTGGA
>probe:Drosophila_2:1640122_at:421:19; Interrogation_Position=459; Antisense; ATAGTAGCGACATCCGGTTCCCAAG
>probe:Drosophila_2:1640122_at:190:147; Interrogation_Position=484; Antisense; ACTCTTGGGAGGATGTCGCGCCGAC
>probe:Drosophila_2:1640122_at:273:535; Interrogation_Position=517; Antisense; GGTCGTGTATAGCAGCACCCTGAAT
>probe:Drosophila_2:1640122_at:419:411; Interrogation_Position=542; Antisense; GACCCAGATATCACGGTTTATCCCG
>probe:Drosophila_2:1640122_at:554:299; Interrogation_Position=567; Antisense; CCCATGTGGCGCTTATGACGCAGTT
>probe:Drosophila_2:1640122_at:315:411; Interrogation_Position=583; Antisense; GACGCAGTTGTCTTAAACTCGAACT
>probe:Drosophila_2:1640122_at:641:143; Interrogation_Position=599; Antisense; ACTCGAACTCGAGCGGGCAATTGCT
>probe:Drosophila_2:1640122_at:651:329; Interrogation_Position=611; Antisense; GCGGGCAATTGCTGATTACGATTAA
>probe:Drosophila_2:1640122_at:125:463; Interrogation_Position=630; Antisense; GATTAACCACTGATTCCTGGGTCGC
>probe:Drosophila_2:1640122_at:218:501; Interrogation_Position=667; Antisense; GTCGTCGGTTCCATTTATCAACTAT
>probe:Drosophila_2:1640122_at:55:693; Interrogation_Position=719; Antisense; TTTCTATCGGTCTGCGGGTTTATAT
>probe:Drosophila_2:1640122_at:522:357; Interrogation_Position=760; Antisense; GCAAATTCGAAGTCACAGTACCCAA

Paste this into a BLAST search page for me
GTGGACTAAGACCAAACCGCCGGATTATGAGCTGCAATATGCCCGCTGGAATAGTAGCGACATCCGGTTCCCAAGACTCTTGGGAGGATGTCGCGCCGACGGTCGTGTATAGCAGCACCCTGAATGACCCAGATATCACGGTTTATCCCGCCCATGTGGCGCTTATGACGCAGTTGACGCAGTTGTCTTAAACTCGAACTACTCGAACTCGAGCGGGCAATTGCTGCGGGCAATTGCTGATTACGATTAAGATTAACCACTGATTCCTGGGTCGCGTCGTCGGTTCCATTTATCAACTATTTTCTATCGGTCTGCGGGTTTATATGCAAATTCGAAGTCACAGTACCCAA

Full Affymetrix probeset data:

Annotations for 1640122_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime