FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640123_at:

>probe:Drosophila_2:1640123_at:122:185; Interrogation_Position=110; Antisense; AAAATGTCGTCCTACATTTCGCGTC
>probe:Drosophila_2:1640123_at:393:17; Interrogation_Position=125; Antisense; ATTTCGCGTCTACTTAAGGCTCAGT
>probe:Drosophila_2:1640123_at:170:185; Interrogation_Position=159; Antisense; AACGTCTGATCTCCAATTTAACCCA
>probe:Drosophila_2:1640123_at:564:243; Interrogation_Position=172; Antisense; CAATTTAACCCAGCGCGACGGAAAG
>probe:Drosophila_2:1640123_at:122:207; Interrogation_Position=194; Antisense; AAGCTAAGCTCTTTGCTTCGACGAC
>probe:Drosophila_2:1640123_at:541:7; Interrogation_Position=299; Antisense; ATTGCGGACGATCAACTGGTCACCG
>probe:Drosophila_2:1640123_at:45:537; Interrogation_Position=316; Antisense; GGTCACCGGGATTCAGAAGCGCGAA
>probe:Drosophila_2:1640123_at:325:713; Interrogation_Position=380; Antisense; TTCAGCAAGGTGATCAGGCGCGGAT
>probe:Drosophila_2:1640123_at:275:587; Interrogation_Position=474; Antisense; TGGATGACCGCTTGCCCAAGTGGAT
>probe:Drosophila_2:1640123_at:649:651; Interrogation_Position=555; Antisense; TCAAGAATGTCCCACCCGTTTAGAT
>probe:Drosophila_2:1640123_at:664:677; Interrogation_Position=575; Antisense; TAGATCGATCACACAGAGCGCTGTA
>probe:Drosophila_2:1640123_at:331:415; Interrogation_Position=590; Antisense; GAGCGCTGTACTTAACACGAACACA
>probe:Drosophila_2:1640123_at:554:135; Interrogation_Position=606; Antisense; ACGAACACACTTGGCATGATCCTCA
>probe:Drosophila_2:1640123_at:716:347; Interrogation_Position=619; Antisense; GCATGATCCTCAGCTGGCATTAAAC

Paste this into a BLAST search page for me
AAAATGTCGTCCTACATTTCGCGTCATTTCGCGTCTACTTAAGGCTCAGTAACGTCTGATCTCCAATTTAACCCACAATTTAACCCAGCGCGACGGAAAGAAGCTAAGCTCTTTGCTTCGACGACATTGCGGACGATCAACTGGTCACCGGGTCACCGGGATTCAGAAGCGCGAATTCAGCAAGGTGATCAGGCGCGGATTGGATGACCGCTTGCCCAAGTGGATTCAAGAATGTCCCACCCGTTTAGATTAGATCGATCACACAGAGCGCTGTAGAGCGCTGTACTTAACACGAACACAACGAACACACTTGGCATGATCCTCAGCATGATCCTCAGCTGGCATTAAAC

Full Affymetrix probeset data:

Annotations for 1640123_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720