FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640124_at:

>probe:Drosophila_2:1640124_at:305:661; Interrogation_Position=1027; Antisense; TAACATTCCAAATCTACCACCTGGC
>probe:Drosophila_2:1640124_at:207:261; Interrogation_Position=1044; Antisense; CACCTGGCGGTGGTCTTTATGCAAA
>probe:Drosophila_2:1640124_at:82:397; Interrogation_Position=1099; Antisense; GAAATTTCCAGATACTCCGGCTGAA
>probe:Drosophila_2:1640124_at:232:663; Interrogation_Position=570; Antisense; TAAATGGCACTCTGGCAGTTTCCCG
>probe:Drosophila_2:1640124_at:584:521; Interrogation_Position=594; Antisense; GGGCCTTCGGTGACTATGATTTCAA
>probe:Drosophila_2:1640124_at:71:59; Interrogation_Position=621; Antisense; ATGATGGCTCAAAGTCTCCTGTCGA
>probe:Drosophila_2:1640124_at:670:499; Interrogation_Position=641; Antisense; GTCGATCAGATGGTGTCTCCGGAAC
>probe:Drosophila_2:1640124_at:419:663; Interrogation_Position=670; Antisense; TATAATAGTTTGCAATCGGTCCGAA
>probe:Drosophila_2:1640124_at:207:13; Interrogation_Position=703; Antisense; ATTCATAGTTGTAGCCTGCGATGGC
>probe:Drosophila_2:1640124_at:591:141; Interrogation_Position=775; Antisense; ACGGCTTTTGGTGACCTATGACCTG
>probe:Drosophila_2:1640124_at:506:681; Interrogation_Position=791; Antisense; TATGACCTGCCGATGATTGTTAACA
>probe:Drosophila_2:1640124_at:251:329; Interrogation_Position=816; Antisense; GCGTATTGGATATTTGCCTGCATAA
>probe:Drosophila_2:1640124_at:728:81; Interrogation_Position=848; Antisense; AGGGACAATATGACACTGCTCCTCC
>probe:Drosophila_2:1640124_at:165:695; Interrogation_Position=877; Antisense; TTTGCCTGGAGCACCAAAGGTCGAT

Paste this into a BLAST search page for me
TAACATTCCAAATCTACCACCTGGCCACCTGGCGGTGGTCTTTATGCAAAGAAATTTCCAGATACTCCGGCTGAATAAATGGCACTCTGGCAGTTTCCCGGGGCCTTCGGTGACTATGATTTCAAATGATGGCTCAAAGTCTCCTGTCGAGTCGATCAGATGGTGTCTCCGGAACTATAATAGTTTGCAATCGGTCCGAAATTCATAGTTGTAGCCTGCGATGGCACGGCTTTTGGTGACCTATGACCTGTATGACCTGCCGATGATTGTTAACAGCGTATTGGATATTTGCCTGCATAAAGGGACAATATGACACTGCTCCTCCTTTGCCTGGAGCACCAAAGGTCGAT

Full Affymetrix probeset data:

Annotations for 1640124_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720