FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640126_at:

>probe:Drosophila_2:1640126_at:688:81; Interrogation_Position=1364; Antisense; AGGGATTATCTCCACTTTGGGCATG
>probe:Drosophila_2:1640126_at:74:619; Interrogation_Position=1395; Antisense; TGCATGTTCCTTTTGGCGGGACATA
>probe:Drosophila_2:1640126_at:78:709; Interrogation_Position=1435; Antisense; TTAAGGAAGTCCCATATCTCCCGGT
>probe:Drosophila_2:1640126_at:415:315; Interrogation_Position=1464; Antisense; GCCATTGTGGGCTTCATTGTGCTGA
>probe:Drosophila_2:1640126_at:342:621; Interrogation_Position=1483; Antisense; TGCTGAGCACTCTAGGTCTTTACAC
>probe:Drosophila_2:1640126_at:366:605; Interrogation_Position=1522; Antisense; TGATCTCCGAGCTTTTTCCGCAAAA
>probe:Drosophila_2:1640126_at:467:253; Interrogation_Position=1541; Antisense; GCAAAAGGTTCGAGGGCCCGCTTCA
>probe:Drosophila_2:1640126_at:418:59; Interrogation_Position=1587; Antisense; ATGTTCATTTCGTTCGTGGTCTTGA
>probe:Drosophila_2:1640126_at:719:723; Interrogation_Position=1608; Antisense; TTGAAGACCTATCCCGGCATCAAGG
>probe:Drosophila_2:1640126_at:64:501; Interrogation_Position=1646; Antisense; GTCGAATTGCTTCATCATTTTTGGG
>probe:Drosophila_2:1640126_at:154:531; Interrogation_Position=1669; Antisense; GGGTCATGGCTCTGTTTGCCCTGAT
>probe:Drosophila_2:1640126_at:701:103; Interrogation_Position=1717; Antisense; AGACGCGTCGTCGAACGCTCTTGGA
>probe:Drosophila_2:1640126_at:87:249; Interrogation_Position=1758; Antisense; CGATCGGGTCGCAGTAAGTCTCAAA
>probe:Drosophila_2:1640126_at:434:449; Interrogation_Position=1884; Antisense; GATCCCGTGAAGTGCTTAGTACTGT

Paste this into a BLAST search page for me
AGGGATTATCTCCACTTTGGGCATGTGCATGTTCCTTTTGGCGGGACATATTAAGGAAGTCCCATATCTCCCGGTGCCATTGTGGGCTTCATTGTGCTGATGCTGAGCACTCTAGGTCTTTACACTGATCTCCGAGCTTTTTCCGCAAAAGCAAAAGGTTCGAGGGCCCGCTTCAATGTTCATTTCGTTCGTGGTCTTGATTGAAGACCTATCCCGGCATCAAGGGTCGAATTGCTTCATCATTTTTGGGGGGTCATGGCTCTGTTTGCCCTGATAGACGCGTCGTCGAACGCTCTTGGACGATCGGGTCGCAGTAAGTCTCAAAGATCCCGTGAAGTGCTTAGTACTGT

Full Affymetrix probeset data:

Annotations for 1640126_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720