FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640127_at:

>probe:Drosophila_2:1640127_at:583:661; Interrogation_Position=2261; Antisense; TAGAAGGCCAGGACGAAACCCCGAT
>probe:Drosophila_2:1640127_at:92:297; Interrogation_Position=2295; Antisense; CGCTGGATGGACATGAACTCGGCAT
>probe:Drosophila_2:1640127_at:82:385; Interrogation_Position=2309; Antisense; GAACTCGGCATGTTTAGCACCTTAG
>probe:Drosophila_2:1640127_at:257:111; Interrogation_Position=2324; Antisense; AGCACCTTAGTGACCTTAGAAACGC
>probe:Drosophila_2:1640127_at:457:105; Interrogation_Position=2341; Antisense; AGAAACGCGTTACCTTCACACAAAT
>probe:Drosophila_2:1640127_at:675:237; Interrogation_Position=2363; Antisense; AATCTGACGAATATGCTCAACCGAT
>probe:Drosophila_2:1640127_at:535:111; Interrogation_Position=2399; Antisense; AGCAACGAATCCCATGAGACCACAT
>probe:Drosophila_2:1640127_at:412:425; Interrogation_Position=2414; Antisense; GAGACCACATATCCAGATGAGTTTT
>probe:Drosophila_2:1640127_at:207:247; Interrogation_Position=2453; Antisense; AATTCTGTATATGTATGCCTTCTCA
>probe:Drosophila_2:1640127_at:20:233; Interrogation_Position=2515; Antisense; AATGCAACAGCATCGAAACTCGGAA
>probe:Drosophila_2:1640127_at:584:391; Interrogation_Position=2537; Antisense; GAAACGAATGTCACCTAGTCCTAAG
>probe:Drosophila_2:1640127_at:597:415; Interrogation_Position=2599; Antisense; GAGCCATTCCTACTTACAATTTGTT
>probe:Drosophila_2:1640127_at:415:19; Interrogation_Position=2617; Antisense; ATTTGTTTTGCGCACTTGGTTTCAA
>probe:Drosophila_2:1640127_at:262:91; Interrogation_Position=2696; Antisense; AGTTGTGACCTTAAGTTCCCTGTAT

Paste this into a BLAST search page for me
TAGAAGGCCAGGACGAAACCCCGATCGCTGGATGGACATGAACTCGGCATGAACTCGGCATGTTTAGCACCTTAGAGCACCTTAGTGACCTTAGAAACGCAGAAACGCGTTACCTTCACACAAATAATCTGACGAATATGCTCAACCGATAGCAACGAATCCCATGAGACCACATGAGACCACATATCCAGATGAGTTTTAATTCTGTATATGTATGCCTTCTCAAATGCAACAGCATCGAAACTCGGAAGAAACGAATGTCACCTAGTCCTAAGGAGCCATTCCTACTTACAATTTGTTATTTGTTTTGCGCACTTGGTTTCAAAGTTGTGACCTTAAGTTCCCTGTAT

Full Affymetrix probeset data:

Annotations for 1640127_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720