FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640129_at:

>probe:Drosophila_2:1640129_at:46:447; Interrogation_Position=1007; Antisense; GATGCAGGGCTATCCACAACAATTG
>probe:Drosophila_2:1640129_at:17:615; Interrogation_Position=1030; Antisense; TGAACGCCGAGTTGTTTCAGCGCAT
>probe:Drosophila_2:1640129_at:527:711; Interrogation_Position=1045; Antisense; TTCAGCGCATGCAGTTCTTTGGCAA
>probe:Drosophila_2:1640129_at:502:563; Interrogation_Position=1065; Antisense; GGCAAGTTTCCATCCAGCTAAATCT
>probe:Drosophila_2:1640129_at:704:339; Interrogation_Position=1081; Antisense; GCTAAATCTTGGCAGTCGGCGCAGA
>probe:Drosophila_2:1640129_at:459:205; Interrogation_Position=1109; Antisense; AAGCCCAGCGCTTTGGATCGAAAAA
>probe:Drosophila_2:1640129_at:277:677; Interrogation_Position=1171; Antisense; TAGGACTGGTAGGACTTCCTGCTCG
>probe:Drosophila_2:1640129_at:425:133; Interrogation_Position=1212; Antisense; ACCCGTGACGTCTAAATGCTGCATT
>probe:Drosophila_2:1640129_at:320:163; Interrogation_Position=1241; Antisense; AAATTCCTTTGGTCATCATCGCATT
>probe:Drosophila_2:1640129_at:407:571; Interrogation_Position=1286; Antisense; GGCTCCTCCGAATCGACTTGGAAAG
>probe:Drosophila_2:1640129_at:281:369; Interrogation_Position=1329; Antisense; GAATGCGCAGCCAAATCTTCAGGAC
>probe:Drosophila_2:1640129_at:211:211; Interrogation_Position=1359; Antisense; AAGAAGGATTCCTGCCAGCCGAGAG
>probe:Drosophila_2:1640129_at:456:103; Interrogation_Position=1380; Antisense; AGAGCCCTTGTAGTTTGCTCACCAA
>probe:Drosophila_2:1640129_at:42:115; Interrogation_Position=946; Antisense; AGCAGATGCAGTACCAGCAGGCTCC

Paste this into a BLAST search page for me
GATGCAGGGCTATCCACAACAATTGTGAACGCCGAGTTGTTTCAGCGCATTTCAGCGCATGCAGTTCTTTGGCAAGGCAAGTTTCCATCCAGCTAAATCTGCTAAATCTTGGCAGTCGGCGCAGAAAGCCCAGCGCTTTGGATCGAAAAATAGGACTGGTAGGACTTCCTGCTCGACCCGTGACGTCTAAATGCTGCATTAAATTCCTTTGGTCATCATCGCATTGGCTCCTCCGAATCGACTTGGAAAGGAATGCGCAGCCAAATCTTCAGGACAAGAAGGATTCCTGCCAGCCGAGAGAGAGCCCTTGTAGTTTGCTCACCAAAGCAGATGCAGTACCAGCAGGCTCC

Full Affymetrix probeset data:

Annotations for 1640129_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720