Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640130_at:

>probe:Drosophila_2:1640130_at:320:349; Interrogation_Position=5045; Antisense; GCAGTGGTGGCAGCACTACCTCATC
>probe:Drosophila_2:1640130_at:622:673; Interrogation_Position=5061; Antisense; TACCTCATCCACCACCAAGAAGAAA
>probe:Drosophila_2:1640130_at:129:705; Interrogation_Position=5096; Antisense; TTAACAACCTCTTTCGCAAGGCCTT
>probe:Drosophila_2:1640130_at:311:359; Interrogation_Position=5111; Antisense; GCAAGGCCTTCGATTTTTAACTAGA
>probe:Drosophila_2:1640130_at:264:675; Interrogation_Position=5132; Antisense; TAGAACCCAGTGTTTCGACTTGTTA
>probe:Drosophila_2:1640130_at:458:137; Interrogation_Position=5157; Antisense; ACGTTTTTAGATTTGCGCATTTGTA
>probe:Drosophila_2:1640130_at:347:541; Interrogation_Position=5191; Antisense; GGATTCGGATTGAACCTGTTGGGTT
>probe:Drosophila_2:1640130_at:427:425; Interrogation_Position=5300; Antisense; GAGAGTTCCTTTTGTGTTGCAGTGA
>probe:Drosophila_2:1640130_at:109:367; Interrogation_Position=5386; Antisense; GAATGCTTGCATGCGTAAGGTAAAC
>probe:Drosophila_2:1640130_at:272:489; Interrogation_Position=5435; Antisense; GTACGTATATTCCAAGCCTCGTCAT
>probe:Drosophila_2:1640130_at:408:497; Interrogation_Position=5455; Antisense; GTCATTCTTGCTACATTCACCCAAT
>probe:Drosophila_2:1640130_at:654:131; Interrogation_Position=5473; Antisense; ACCCAATCCCACAGTTATCTACATT
>probe:Drosophila_2:1640130_at:674:177; Interrogation_Position=5510; Antisense; AAACATTTGCAAGTTGTTGCCACAC
>probe:Drosophila_2:1640130_at:597:467; Interrogation_Position=5522; Antisense; GTTGTTGCCACACATTTAGTTTGTT

Paste this into a BLAST search page for me
GCAGTGGTGGCAGCACTACCTCATCTACCTCATCCACCACCAAGAAGAAATTAACAACCTCTTTCGCAAGGCCTTGCAAGGCCTTCGATTTTTAACTAGATAGAACCCAGTGTTTCGACTTGTTAACGTTTTTAGATTTGCGCATTTGTAGGATTCGGATTGAACCTGTTGGGTTGAGAGTTCCTTTTGTGTTGCAGTGAGAATGCTTGCATGCGTAAGGTAAACGTACGTATATTCCAAGCCTCGTCATGTCATTCTTGCTACATTCACCCAATACCCAATCCCACAGTTATCTACATTAAACATTTGCAAGTTGTTGCCACACGTTGTTGCCACACATTTAGTTTGTT

Full Affymetrix probeset data:

Annotations for 1640130_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime