FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640133_at:

>probe:Drosophila_2:1640133_at:480:147; Interrogation_Position=1054; Antisense; ACTATCGCTCAAAAGGTCACGCCCA
>probe:Drosophila_2:1640133_at:141:71; Interrogation_Position=1093; Antisense; AGGCGGCACTGGACAATCCTGTGGA
>probe:Drosophila_2:1640133_at:115:371; Interrogation_Position=1127; Antisense; GAAGGCCAGTAACGGCATGCAGACA
>probe:Drosophila_2:1640133_at:648:65; Interrogation_Position=1215; Antisense; ATGGATCCCCGATCTGATATTCGGA
>probe:Drosophila_2:1640133_at:113:397; Interrogation_Position=724; Antisense; GACACACCGGCGTAAAGAGCTTTGC
>probe:Drosophila_2:1640133_at:185:173; Interrogation_Position=737; Antisense; AAAGAGCTTTGCCTGTGACCAGTGC
>probe:Drosophila_2:1640133_at:124:93; Interrogation_Position=769; Antisense; AGTTCTACACTGCTACGCTTCTGCG
>probe:Drosophila_2:1640133_at:725:231; Interrogation_Position=819; Antisense; AATGCTTTGTTTCAGTGTCGCTACT
>probe:Drosophila_2:1640133_at:39:341; Interrogation_Position=838; Antisense; GCTACTGCGAGGCAACCTACAGCAA
>probe:Drosophila_2:1640133_at:287:51; Interrogation_Position=891; Antisense; ATGCGCCACACGAATGTCAAGCCCT
>probe:Drosophila_2:1640133_at:125:173; Interrogation_Position=937; Antisense; AAAGCTTTGCCATGAGCGGAAAACT
>probe:Drosophila_2:1640133_at:191:389; Interrogation_Position=955; Antisense; GAAAACTCCGCACGCACATGCTGAG
>probe:Drosophila_2:1640133_at:600:51; Interrogation_Position=972; Antisense; ATGCTGAGTCACACCGGAGTGCGAG
>probe:Drosophila_2:1640133_at:42:551; Interrogation_Position=987; Antisense; GGAGTGCGAGCGTTCCACTGCGACT

Paste this into a BLAST search page for me
ACTATCGCTCAAAAGGTCACGCCCAAGGCGGCACTGGACAATCCTGTGGAGAAGGCCAGTAACGGCATGCAGACAATGGATCCCCGATCTGATATTCGGAGACACACCGGCGTAAAGAGCTTTGCAAAGAGCTTTGCCTGTGACCAGTGCAGTTCTACACTGCTACGCTTCTGCGAATGCTTTGTTTCAGTGTCGCTACTGCTACTGCGAGGCAACCTACAGCAAATGCGCCACACGAATGTCAAGCCCTAAAGCTTTGCCATGAGCGGAAAACTGAAAACTCCGCACGCACATGCTGAGATGCTGAGTCACACCGGAGTGCGAGGGAGTGCGAGCGTTCCACTGCGACT

Full Affymetrix probeset data:

Annotations for 1640133_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720