FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640138_at:

>probe:Drosophila_2:1640138_at:137:389; Interrogation_Position=1006; Antisense; GAAAACCGCAATGCACCAGACCAAG
>probe:Drosophila_2:1640138_at:149:415; Interrogation_Position=1024; Antisense; GACCAAGAGCTCATGCAGGCAACGT
>probe:Drosophila_2:1640138_at:120:349; Interrogation_Position=1038; Antisense; GCAGGCAACGTCTTCAGCACGAGTA
>probe:Drosophila_2:1640138_at:533:211; Interrogation_Position=1112; Antisense; AAGAACGCACTGGACTAGCGCGATT
>probe:Drosophila_2:1640138_at:296:403; Interrogation_Position=1124; Antisense; GACTAGCGCGATTACGATCCAACAA
>probe:Drosophila_2:1640138_at:386:183; Interrogation_Position=1144; Antisense; AACAAGCGTAATAATCCGTCCTGAT
>probe:Drosophila_2:1640138_at:673:45; Interrogation_Position=1157; Antisense; ATCCGTCCTGATTTACAAAACTCTA
>probe:Drosophila_2:1640138_at:657:655; Interrogation_Position=683; Antisense; TAAGTGTTTCTTTAAAGCCGGCTGT
>probe:Drosophila_2:1640138_at:237:125; Interrogation_Position=698; Antisense; AGCCGGCTGTTATTCTTGTGGTTCA
>probe:Drosophila_2:1640138_at:699:695; Interrogation_Position=800; Antisense; TTTCTTTGCGCTTTAACGAACGAAT
>probe:Drosophila_2:1640138_at:148:729; Interrogation_Position=845; Antisense; TTGGGCCAAGTGAAATCTGCTGCTG
>probe:Drosophila_2:1640138_at:571:639; Interrogation_Position=860; Antisense; TCTGCTGCTGGTCATTTTACGGACA
>probe:Drosophila_2:1640138_at:553:467; Interrogation_Position=952; Antisense; GTTGAATTTCCGGAAGCTCGTATAT
>probe:Drosophila_2:1640138_at:642:375; Interrogation_Position=979; Antisense; GAAGAAACGCTACAAGTCTTGCTTT

Paste this into a BLAST search page for me
GAAAACCGCAATGCACCAGACCAAGGACCAAGAGCTCATGCAGGCAACGTGCAGGCAACGTCTTCAGCACGAGTAAAGAACGCACTGGACTAGCGCGATTGACTAGCGCGATTACGATCCAACAAAACAAGCGTAATAATCCGTCCTGATATCCGTCCTGATTTACAAAACTCTATAAGTGTTTCTTTAAAGCCGGCTGTAGCCGGCTGTTATTCTTGTGGTTCATTTCTTTGCGCTTTAACGAACGAATTTGGGCCAAGTGAAATCTGCTGCTGTCTGCTGCTGGTCATTTTACGGACAGTTGAATTTCCGGAAGCTCGTATATGAAGAAACGCTACAAGTCTTGCTTT

Full Affymetrix probeset data:

Annotations for 1640138_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720