FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640139_at:

>probe:Drosophila_2:1640139_at:245:511; Interrogation_Position=2525; Antisense; GTGAAAACATTTTTCCCTCATTCAA
>probe:Drosophila_2:1640139_at:276:719; Interrogation_Position=2537; Antisense; TTCCCTCATTCAAAATGCCAGCAAG
>probe:Drosophila_2:1640139_at:96:165; Interrogation_Position=2629; Antisense; AAATGTTCCACTATAGTTACCAATA
>probe:Drosophila_2:1640139_at:564:475; Interrogation_Position=2644; Antisense; GTTACCAATATTTTTGACACAGCTG
>probe:Drosophila_2:1640139_at:648:119; Interrogation_Position=2664; Antisense; AGCTGTAGATAAGACGTGCTTGCTA
>probe:Drosophila_2:1640139_at:522:179; Interrogation_Position=2701; Antisense; AAAAATCATGTCTGTACTGCCACTG
>probe:Drosophila_2:1640139_at:225:499; Interrogation_Position=2710; Antisense; GTCTGTACTGCCACTGAAAATGTAT
>probe:Drosophila_2:1640139_at:628:491; Interrogation_Position=2812; Antisense; GTAACAGTATTAGACACTCCCCATG
>probe:Drosophila_2:1640139_at:45:303; Interrogation_Position=2830; Antisense; CCCCATGTTCATCTGTTTCCAAGAA
>probe:Drosophila_2:1640139_at:651:127; Interrogation_Position=2926; Antisense; ACCTAGCTATAGATGCAATTTTGTA
>probe:Drosophila_2:1640139_at:427:231; Interrogation_Position=2961; Antisense; AATGATTTTTGTACATACGCAGCAG
>probe:Drosophila_2:1640139_at:593:151; Interrogation_Position=2973; Antisense; ACATACGCAGCAGACCAACAACATA
>probe:Drosophila_2:1640139_at:70:699; Interrogation_Position=3049; Antisense; TTTTTTGTGCCTAGTCCTAAGACGT
>probe:Drosophila_2:1640139_at:109:87; Interrogation_Position=3061; Antisense; AGTCCTAAGACGTCTATTGTGTGTA

Paste this into a BLAST search page for me
GTGAAAACATTTTTCCCTCATTCAATTCCCTCATTCAAAATGCCAGCAAGAAATGTTCCACTATAGTTACCAATAGTTACCAATATTTTTGACACAGCTGAGCTGTAGATAAGACGTGCTTGCTAAAAAATCATGTCTGTACTGCCACTGGTCTGTACTGCCACTGAAAATGTATGTAACAGTATTAGACACTCCCCATGCCCCATGTTCATCTGTTTCCAAGAAACCTAGCTATAGATGCAATTTTGTAAATGATTTTTGTACATACGCAGCAGACATACGCAGCAGACCAACAACATATTTTTTGTGCCTAGTCCTAAGACGTAGTCCTAAGACGTCTATTGTGTGTA

Full Affymetrix probeset data:

Annotations for 1640139_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720