FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640142_at:

>probe:Drosophila_2:1640142_at:652:57; Interrogation_Position=1087; Antisense; ATGAGTTTGCGCAGCTTTGTCGATC
>probe:Drosophila_2:1640142_at:720:457; Interrogation_Position=1119; Antisense; GATTGAGTCAATGCGTCTGGCCGGC
>probe:Drosophila_2:1640142_at:123:613; Interrogation_Position=1148; Antisense; TGACACGTGACTATCGCCGTCGGGA
>probe:Drosophila_2:1640142_at:560:347; Interrogation_Position=1188; Antisense; GCAGGAAGGAGCACGCCGCAAGTAC
>probe:Drosophila_2:1640142_at:362:211; Interrogation_Position=1219; Antisense; AAGAAGCGCTAGACGGGCACGTGCA
>probe:Drosophila_2:1640142_at:510:509; Interrogation_Position=1239; Antisense; GTGCATCTGCAACACTAGGCTGCAT
>probe:Drosophila_2:1640142_at:192:449; Interrogation_Position=723; Antisense; GATCGCATCGCCATATGCTTACAAG
>probe:Drosophila_2:1640142_at:381:421; Interrogation_Position=747; Antisense; GAGCAAAGCATTCATCGAGCGATAC
>probe:Drosophila_2:1640142_at:98:613; Interrogation_Position=773; Antisense; TGAAACCGCTGATGGACCAGTCCAA
>probe:Drosophila_2:1640142_at:591:549; Interrogation_Position=804; Antisense; GGAGGTGCCCAAACCAAGGATCGAT
>probe:Drosophila_2:1640142_at:138:433; Interrogation_Position=859; Antisense; GAGTGCCTGCGCAAAACTGCTAGAG
>probe:Drosophila_2:1640142_at:119:285; Interrogation_Position=875; Antisense; CTGCTAGAGCCGATGTCACAGTGCG
>probe:Drosophila_2:1640142_at:666:153; Interrogation_Position=892; Antisense; ACAGTGCGGCTACCCGGAACAGGAA
>probe:Drosophila_2:1640142_at:446:615; Interrogation_Position=989; Antisense; TGCAATTTAGCGAGCTGCTGGGCAA

Paste this into a BLAST search page for me
ATGAGTTTGCGCAGCTTTGTCGATCGATTGAGTCAATGCGTCTGGCCGGCTGACACGTGACTATCGCCGTCGGGAGCAGGAAGGAGCACGCCGCAAGTACAAGAAGCGCTAGACGGGCACGTGCAGTGCATCTGCAACACTAGGCTGCATGATCGCATCGCCATATGCTTACAAGGAGCAAAGCATTCATCGAGCGATACTGAAACCGCTGATGGACCAGTCCAAGGAGGTGCCCAAACCAAGGATCGATGAGTGCCTGCGCAAAACTGCTAGAGCTGCTAGAGCCGATGTCACAGTGCGACAGTGCGGCTACCCGGAACAGGAATGCAATTTAGCGAGCTGCTGGGCAA

Full Affymetrix probeset data:

Annotations for 1640142_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720