Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640143_at:

>probe:Drosophila_2:1640143_at:96:707; Interrogation_Position=1344; Antisense; TTACATCGAGGAGTGTGCCGCCAAG
>probe:Drosophila_2:1640143_at:579:565; Interrogation_Position=1390; Antisense; GGCAATGGCGACATACTCAGCTACG
>probe:Drosophila_2:1640143_at:215:315; Interrogation_Position=1443; Antisense; GCCTCACGTTTGCTCCGTAATGATT
>probe:Drosophila_2:1640143_at:639:291; Interrogation_Position=1458; Antisense; CGTAATGATTGGACGCGGCGCGTTA
>probe:Drosophila_2:1640143_at:246:215; Interrogation_Position=1564; Antisense; AAGTTCTGCAACTACGGACTGGAGC
>probe:Drosophila_2:1640143_at:635:227; Interrogation_Position=1640; Antisense; AATGGCAGTCCTTCTTGTACCGATA
>probe:Drosophila_2:1640143_at:424:455; Interrogation_Position=1661; Antisense; GATACATACCCGAGGCTTTGCAGAC
>probe:Drosophila_2:1640143_at:185:97; Interrogation_Position=1700; Antisense; AGATCAACGCTCGACCGCAAAAGTA
>probe:Drosophila_2:1640143_at:427:555; Interrogation_Position=1729; Antisense; GGACGCGACGAAATGGAGACCCTTA
>probe:Drosophila_2:1640143_at:599:421; Interrogation_Position=1744; Antisense; GAGACCCTTATGAGTTCCGGCAACG
>probe:Drosophila_2:1640143_at:431:631; Interrogation_Position=1759; Antisense; TCCGGCAACGCAGCTGACTGGGTAA
>probe:Drosophila_2:1640143_at:261:209; Interrogation_Position=1783; Antisense; AAGCTTAGTGAATCGCTGCTGGGTC
>probe:Drosophila_2:1640143_at:393:371; Interrogation_Position=1816; Antisense; GAAGGCTTCACCTTTGTACCCAAGC
>probe:Drosophila_2:1640143_at:128:369; Interrogation_Position=1848; Antisense; GAATGCCTTCTAGGTTTCTTTCGTG

Paste this into a BLAST search page for me
TTACATCGAGGAGTGTGCCGCCAAGGGCAATGGCGACATACTCAGCTACGGCCTCACGTTTGCTCCGTAATGATTCGTAATGATTGGACGCGGCGCGTTAAAGTTCTGCAACTACGGACTGGAGCAATGGCAGTCCTTCTTGTACCGATAGATACATACCCGAGGCTTTGCAGACAGATCAACGCTCGACCGCAAAAGTAGGACGCGACGAAATGGAGACCCTTAGAGACCCTTATGAGTTCCGGCAACGTCCGGCAACGCAGCTGACTGGGTAAAAGCTTAGTGAATCGCTGCTGGGTCGAAGGCTTCACCTTTGTACCCAAGCGAATGCCTTCTAGGTTTCTTTCGTG

Full Affymetrix probeset data:

Annotations for 1640143_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime