FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640144_at:

>probe:Drosophila_2:1640144_at:726:77; Interrogation_Position=227; Antisense; AGGATCATCACGGATGCCGACTCCA
>probe:Drosophila_2:1640144_at:411:263; Interrogation_Position=262; Antisense; CAGCTCGCACGATTATGGTCACGGT
>probe:Drosophila_2:1640144_at:148:591; Interrogation_Position=277; Antisense; TGGTCACGGTGGGAGCTATAACAAT
>probe:Drosophila_2:1640144_at:72:685; Interrogation_Position=304; Antisense; TATCATCAATGGTGGCTCGGGATCC
>probe:Drosophila_2:1640144_at:382:529; Interrogation_Position=322; Antisense; GGGATCCAGCGTAATTCATGGCGAT
>probe:Drosophila_2:1640144_at:178:649; Interrogation_Position=337; Antisense; TCATGGCGATGGACATAGCTTCATT
>probe:Drosophila_2:1640144_at:465:229; Interrogation_Position=422; Antisense; AATGGTGCCATCGAACTCAATGATC
>probe:Drosophila_2:1640144_at:238:455; Interrogation_Position=443; Antisense; GATCACGGCCAGGTGTACACATTCA
>probe:Drosophila_2:1640144_at:725:31; Interrogation_Position=509; Antisense; ATCAACGGACAACCGGCTCAGGTGG
>probe:Drosophila_2:1640144_at:691:295; Interrogation_Position=559; Antisense; CGAACTGGCCGATCATACGGTGATT
>probe:Drosophila_2:1640144_at:57:81; Interrogation_Position=592; Antisense; AGGTGGACGCACATTTCTGGGCGAT
>probe:Drosophila_2:1640144_at:111:451; Interrogation_Position=614; Antisense; GATCGCGAATCCTTCGACAATCGGG
>probe:Drosophila_2:1640144_at:373:385; Interrogation_Position=661; Antisense; GAACTATGCCGATCGTATCCAGCAA
>probe:Drosophila_2:1640144_at:294:101; Interrogation_Position=685; Antisense; AGAGGTGCACGCCAATCTCCAGAAA

Paste this into a BLAST search page for me
AGGATCATCACGGATGCCGACTCCACAGCTCGCACGATTATGGTCACGGTTGGTCACGGTGGGAGCTATAACAATTATCATCAATGGTGGCTCGGGATCCGGGATCCAGCGTAATTCATGGCGATTCATGGCGATGGACATAGCTTCATTAATGGTGCCATCGAACTCAATGATCGATCACGGCCAGGTGTACACATTCAATCAACGGACAACCGGCTCAGGTGGCGAACTGGCCGATCATACGGTGATTAGGTGGACGCACATTTCTGGGCGATGATCGCGAATCCTTCGACAATCGGGGAACTATGCCGATCGTATCCAGCAAAGAGGTGCACGCCAATCTCCAGAAA

Full Affymetrix probeset data:

Annotations for 1640144_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720