FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640145_at:

>probe:Drosophila_2:1640145_at:195:427; Interrogation_Position=1036; Antisense; GAGATGGCCTATTCGGGAGCTAACT
>probe:Drosophila_2:1640145_at:524:21; Interrogation_Position=1063; Antisense; ATATTCATCCGTTACTTTCTGGACA
>probe:Drosophila_2:1640145_at:536:667; Interrogation_Position=1075; Antisense; TACTTTCTGGACAAGCGGTATGCTC
>probe:Drosophila_2:1640145_at:612:51; Interrogation_Position=1094; Antisense; ATGCTCTGCCTTATCGCGTCGTGGA
>probe:Drosophila_2:1640145_at:419:447; Interrogation_Position=1117; Antisense; GATGCCGCAGTCTTTCATTTTCTAA
>probe:Drosophila_2:1640145_at:545:397; Interrogation_Position=1153; Antisense; GACAAGCGTGAGTTACCAGTGCTAT
>probe:Drosophila_2:1640145_at:1:651; Interrogation_Position=1193; Antisense; TCACCTTTGCCCAGCGATACAAGAA
>probe:Drosophila_2:1640145_at:70:383; Interrogation_Position=1215; Antisense; GAACGATATATCCTCCGAACAGCGG
>probe:Drosophila_2:1640145_at:723:187; Interrogation_Position=1232; Antisense; AACAGCGGGATGCACTGCTGCAGCT
>probe:Drosophila_2:1640145_at:403:415; Interrogation_Position=1269; Antisense; GAGCCATTTCAAGATTACACCCGAT
>probe:Drosophila_2:1640145_at:586:629; Interrogation_Position=1307; Antisense; TCCAGGCGGCCAGTTGTCGCGATGT
>probe:Drosophila_2:1640145_at:37:527; Interrogation_Position=1363; Antisense; GGGCAGCCAGCCAAGATGTACACAG
>probe:Drosophila_2:1640145_at:553:325; Interrogation_Position=938; Antisense; GCGATTGCACATTGCGCGAGGCCAT
>probe:Drosophila_2:1640145_at:657:439; Interrogation_Position=955; Antisense; GAGGCCATCATTTTCGGCAGTGTGG

Paste this into a BLAST search page for me
GAGATGGCCTATTCGGGAGCTAACTATATTCATCCGTTACTTTCTGGACATACTTTCTGGACAAGCGGTATGCTCATGCTCTGCCTTATCGCGTCGTGGAGATGCCGCAGTCTTTCATTTTCTAAGACAAGCGTGAGTTACCAGTGCTATTCACCTTTGCCCAGCGATACAAGAAGAACGATATATCCTCCGAACAGCGGAACAGCGGGATGCACTGCTGCAGCTGAGCCATTTCAAGATTACACCCGATTCCAGGCGGCCAGTTGTCGCGATGTGGGCAGCCAGCCAAGATGTACACAGGCGATTGCACATTGCGCGAGGCCATGAGGCCATCATTTTCGGCAGTGTGG

Full Affymetrix probeset data:

Annotations for 1640145_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720