Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640146_at:

>probe:Drosophila_2:1640146_at:494:397; Interrogation_Position=1964; Antisense; GACAAGTGATCTAATCTGCTGCTAA
>probe:Drosophila_2:1640146_at:69:579; Interrogation_Position=2026; Antisense; GGCCAGGCAAGTTTCAATCCGCAAA
>probe:Drosophila_2:1640146_at:516:155; Interrogation_Position=2071; Antisense; ACAGAGCAGCTAACTACTTGTTCTA
>probe:Drosophila_2:1640146_at:569:149; Interrogation_Position=2086; Antisense; ACTTGTTCTAGCCTTTAGCTTTCCA
>probe:Drosophila_2:1640146_at:521:117; Interrogation_Position=2102; Antisense; AGCTTTCCAACTTCATTGCTACGGT
>probe:Drosophila_2:1640146_at:525:139; Interrogation_Position=2122; Antisense; ACGGTTACGCATATTTATCCTTCTA
>probe:Drosophila_2:1640146_at:181:655; Interrogation_Position=2145; Antisense; TAATTAAAAACGCTCGCTTCCGCTG
>probe:Drosophila_2:1640146_at:670:343; Interrogation_Position=2160; Antisense; GCTTCCGCTGACCTTGAATAGCAAT
>probe:Drosophila_2:1640146_at:646:393; Interrogation_Position=2256; Antisense; GAAATGCTCCACAAACACGAATACA
>probe:Drosophila_2:1640146_at:359:277; Interrogation_Position=2299; Antisense; CTAAATAACCGCAAAGACCTCTAAT
>probe:Drosophila_2:1640146_at:397:389; Interrogation_Position=2367; Antisense; GAAACCCAATGTCATTCAACTGTAA
>probe:Drosophila_2:1640146_at:225:657; Interrogation_Position=2389; Antisense; TAATGTGACGTCGTCCATAGCGCCA
>probe:Drosophila_2:1640146_at:288:313; Interrogation_Position=2410; Antisense; GCCACTGCACGCTTTATTGTATGGA
>probe:Drosophila_2:1640146_at:175:303; Interrogation_Position=2467; Antisense; CCCGCCCCAGTACACATTGTGTTAA

Paste this into a BLAST search page for me
GACAAGTGATCTAATCTGCTGCTAAGGCCAGGCAAGTTTCAATCCGCAAAACAGAGCAGCTAACTACTTGTTCTAACTTGTTCTAGCCTTTAGCTTTCCAAGCTTTCCAACTTCATTGCTACGGTACGGTTACGCATATTTATCCTTCTATAATTAAAAACGCTCGCTTCCGCTGGCTTCCGCTGACCTTGAATAGCAATGAAATGCTCCACAAACACGAATACACTAAATAACCGCAAAGACCTCTAATGAAACCCAATGTCATTCAACTGTAATAATGTGACGTCGTCCATAGCGCCAGCCACTGCACGCTTTATTGTATGGACCCGCCCCAGTACACATTGTGTTAA

Full Affymetrix probeset data:

Annotations for 1640146_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime