FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640147_at:

>probe:Drosophila_2:1640147_at:654:133; Interrogation_Position=412; Antisense; ACGCCCACAGACACGCCGAAAATAT
>probe:Drosophila_2:1640147_at:588:163; Interrogation_Position=455; Antisense; AAATATCGCCGAACAAGTCGCCAAA
>probe:Drosophila_2:1640147_at:592:311; Interrogation_Position=474; Antisense; GCCAAAAACTTTCTCGATGATGCAA
>probe:Drosophila_2:1640147_at:316:211; Interrogation_Position=538; Antisense; AAGAAGCCGAAAACGCCAGCAGTGA
>probe:Drosophila_2:1640147_at:363:511; Interrogation_Position=559; Antisense; GTGAAATCACCAATTGAACCCATTA
>probe:Drosophila_2:1640147_at:39:381; Interrogation_Position=574; Antisense; GAACCCATTATATTACCAACAGAGT
>probe:Drosophila_2:1640147_at:306:81; Interrogation_Position=594; Antisense; AGAGTCCCAATTGAAATCTCCGATA
>probe:Drosophila_2:1640147_at:247:609; Interrogation_Position=680; Antisense; TGAAGTCCGAAAAGAATTCCCCTGA
>probe:Drosophila_2:1640147_at:348:285; Interrogation_Position=701; Antisense; CTGAAGCCCATTTCTCTGGAGAAGT
>probe:Drosophila_2:1640147_at:682:215; Interrogation_Position=752; Antisense; AAGATATTTCGGAGCCACCTTCAAA
>probe:Drosophila_2:1640147_at:263:179; Interrogation_Position=775; Antisense; AAACAGCCTCGTCTACATATTTTGC
>probe:Drosophila_2:1640147_at:85:305; Interrogation_Position=817; Antisense; CCATTCGCAATGACGCACAGCAAAA
>probe:Drosophila_2:1640147_at:126:377; Interrogation_Position=883; Antisense; GAAGCAAAAGAAGCACCTCCTGACA
>probe:Drosophila_2:1640147_at:97:355; Interrogation_Position=895; Antisense; GCACCTCCTGACAATTTAAGCGAAA

Paste this into a BLAST search page for me
ACGCCCACAGACACGCCGAAAATATAAATATCGCCGAACAAGTCGCCAAAGCCAAAAACTTTCTCGATGATGCAAAAGAAGCCGAAAACGCCAGCAGTGAGTGAAATCACCAATTGAACCCATTAGAACCCATTATATTACCAACAGAGTAGAGTCCCAATTGAAATCTCCGATATGAAGTCCGAAAAGAATTCCCCTGACTGAAGCCCATTTCTCTGGAGAAGTAAGATATTTCGGAGCCACCTTCAAAAAACAGCCTCGTCTACATATTTTGCCCATTCGCAATGACGCACAGCAAAAGAAGCAAAAGAAGCACCTCCTGACAGCACCTCCTGACAATTTAAGCGAAA

Full Affymetrix probeset data:

Annotations for 1640147_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720