Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640149_at:

>probe:Drosophila_2:1640149_at:606:413; Interrogation_Position=1350; Antisense; GAGCCTTGGGATTAATCGTAATTTG
>probe:Drosophila_2:1640149_at:591:265; Interrogation_Position=1392; Antisense; CAGAGTTTTGTGGTCAATGCACAGC
>probe:Drosophila_2:1640149_at:11:233; Interrogation_Position=1407; Antisense; AATGCACAGCAGTTTGTCCCTATTT
>probe:Drosophila_2:1640149_at:542:503; Interrogation_Position=1422; Antisense; GTCCCTATTTGAAGGATCTGTAGTT
>probe:Drosophila_2:1640149_at:126:127; Interrogation_Position=1459; Antisense; ACCAATTAGCATTTCGATTTGTACA
>probe:Drosophila_2:1640149_at:196:489; Interrogation_Position=1479; Antisense; GTACAGAATACATATGTGTGCCAGT
>probe:Drosophila_2:1640149_at:564:63; Interrogation_Position=1492; Antisense; ATGTGTGCCAGTATATACCTATATA
>probe:Drosophila_2:1640149_at:660:667; Interrogation_Position=1529; Antisense; TACTTTCATTCTTCCTATTCTTTGC
>probe:Drosophila_2:1640149_at:562:273; Interrogation_Position=1535; Antisense; CATTCTTCCTATTCTTTGCTTTATA
>probe:Drosophila_2:1640149_at:147:701; Interrogation_Position=1565; Antisense; TTTTTGCCTGCACCAGTTATTTTTT
>probe:Drosophila_2:1640149_at:248:565; Interrogation_Position=1751; Antisense; GGAATCATTTGCATATTTCACACCA
>probe:Drosophila_2:1640149_at:442:527; Interrogation_Position=1823; Antisense; GGGAGAACAATTCATTTGCTTCTTA
>probe:Drosophila_2:1640149_at:403:341; Interrogation_Position=1840; Antisense; GCTTCTTAAACGCTTAAATCAATCG
>probe:Drosophila_2:1640149_at:695:683; Interrogation_Position=1867; Antisense; TATCAGCTTTCGTAGTTATATAGAC

Paste this into a BLAST search page for me
GAGCCTTGGGATTAATCGTAATTTGCAGAGTTTTGTGGTCAATGCACAGCAATGCACAGCAGTTTGTCCCTATTTGTCCCTATTTGAAGGATCTGTAGTTACCAATTAGCATTTCGATTTGTACAGTACAGAATACATATGTGTGCCAGTATGTGTGCCAGTATATACCTATATATACTTTCATTCTTCCTATTCTTTGCCATTCTTCCTATTCTTTGCTTTATATTTTTGCCTGCACCAGTTATTTTTTGGAATCATTTGCATATTTCACACCAGGGAGAACAATTCATTTGCTTCTTAGCTTCTTAAACGCTTAAATCAATCGTATCAGCTTTCGTAGTTATATAGAC

Full Affymetrix probeset data:

Annotations for 1640149_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime