Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640150_s_at:

>probe:Drosophila_2:1640150_s_at:649:327; Interrogation_Position=160; Antisense; GCGTATGAACGTATTGGCCGATGCC
>probe:Drosophila_2:1640150_s_at:464:615; Interrogation_Position=186; Antisense; TGAAGTGCATAAACAACGCCGAGAA
>probe:Drosophila_2:1640150_s_at:477:621; Interrogation_Position=231; Antisense; TGCTGCGTCCCTGCTCCAAGGTGAT
>probe:Drosophila_2:1640150_s_at:522:653; Interrogation_Position=258; Antisense; TCAAGTTCCTGACCGTGATGATGAA
>probe:Drosophila_2:1640150_s_at:34:377; Interrogation_Position=280; Antisense; GAAGCATGGCTATATCGGCGAATTC
>probe:Drosophila_2:1640150_s_at:299:23; Interrogation_Position=291; Antisense; ATATCGGCGAATTCGAGATCGTCGA
>probe:Drosophila_2:1640150_s_at:422:249; Interrogation_Position=331; Antisense; CAAGATCGTTGTCAACCTGACCGGT
>probe:Drosophila_2:1640150_s_at:643:237; Interrogation_Position=428; Antisense; AATCTGTTGCCCTCGCGTCAGTTTG
>probe:Drosophila_2:1640150_s_at:253:497; Interrogation_Position=444; Antisense; GTCAGTTTGGTTACGTTGTGCTCAC
>probe:Drosophila_2:1640150_s_at:41:289; Interrogation_Position=474; Antisense; CTGGCGGCATCATGGACCACGAGGA
>probe:Drosophila_2:1640150_s_at:271:529; Interrogation_Position=517; Antisense; GGGAGGCAAAATTCTCGGCTTCTTC
>probe:Drosophila_2:1640150_s_at:569:609; Interrogation_Position=594; Antisense; TGACGTTTTATTTCACCGACCATGC
>probe:Drosophila_2:1640150_s_at:143:311; Interrogation_Position=621; Antisense; CCAACTATGTACTTTGTGCACAGGA
>probe:Drosophila_2:1640150_s_at:728:367; Interrogation_Position=695; Antisense; GAATGTTCACAAAGTTACGCGAAAT

Paste this into a BLAST search page for me
GCGTATGAACGTATTGGCCGATGCCTGAAGTGCATAAACAACGCCGAGAATGCTGCGTCCCTGCTCCAAGGTGATTCAAGTTCCTGACCGTGATGATGAAGAAGCATGGCTATATCGGCGAATTCATATCGGCGAATTCGAGATCGTCGACAAGATCGTTGTCAACCTGACCGGTAATCTGTTGCCCTCGCGTCAGTTTGGTCAGTTTGGTTACGTTGTGCTCACCTGGCGGCATCATGGACCACGAGGAGGGAGGCAAAATTCTCGGCTTCTTCTGACGTTTTATTTCACCGACCATGCCCAACTATGTACTTTGTGCACAGGAGAATGTTCACAAAGTTACGCGAAAT

Full Affymetrix probeset data:

Annotations for 1640150_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime