Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640151_at:

>probe:Drosophila_2:1640151_at:55:257; Interrogation_Position=3333; Antisense; CAAATTCTCAAATGCCTGGTGCTAC
>probe:Drosophila_2:1640151_at:638:135; Interrogation_Position=3375; Antisense; ACGAACTCTAAAACGCAGCCAGGAT
>probe:Drosophila_2:1640151_at:159:249; Interrogation_Position=3437; Antisense; AATTGGATGTCGTATCCGCTGGAAA
>probe:Drosophila_2:1640151_at:722:109; Interrogation_Position=3479; Antisense; AGAAGGCAATCTGCTCCGGATTCTT
>probe:Drosophila_2:1640151_at:243:435; Interrogation_Position=3532; Antisense; GAGGGATATCGTACCCTGGTCGACT
>probe:Drosophila_2:1640151_at:329:403; Interrogation_Position=3553; Antisense; GACTCCCAGGTCGTTTACATTCATC
>probe:Drosophila_2:1640151_at:617:653; Interrogation_Position=3593; Antisense; TCAATCGCCAGCCAGAGTGGGTCAT
>probe:Drosophila_2:1640151_at:498:433; Interrogation_Position=3607; Antisense; GAGTGGGTCATCTATCACGAGCTGG
>probe:Drosophila_2:1640151_at:458:65; Interrogation_Position=3681; Antisense; ATGGTTGGTGGAATTTGCTCCGTCC
>probe:Drosophila_2:1640151_at:401:289; Interrogation_Position=3719; Antisense; CGGACCCCACGAAGCTAAGCAAATT
>probe:Drosophila_2:1640151_at:189:125; Interrogation_Position=3755; Antisense; AGCGCCTGGAGCCACTGTACAATAA
>probe:Drosophila_2:1640151_at:571:437; Interrogation_Position=3784; Antisense; GAGGAGCCCAATGCCTGGCGTATCT
>probe:Drosophila_2:1640151_at:634:131; Interrogation_Position=3810; Antisense; ACGCGTTCGTCGACGTCGCAATTAA
>probe:Drosophila_2:1640151_at:702:555; Interrogation_Position=3836; Antisense; GGACTAAGCCCGTTTATGTCTGTAA

Paste this into a BLAST search page for me
CAAATTCTCAAATGCCTGGTGCTACACGAACTCTAAAACGCAGCCAGGATAATTGGATGTCGTATCCGCTGGAAAAGAAGGCAATCTGCTCCGGATTCTTGAGGGATATCGTACCCTGGTCGACTGACTCCCAGGTCGTTTACATTCATCTCAATCGCCAGCCAGAGTGGGTCATGAGTGGGTCATCTATCACGAGCTGGATGGTTGGTGGAATTTGCTCCGTCCCGGACCCCACGAAGCTAAGCAAATTAGCGCCTGGAGCCACTGTACAATAAGAGGAGCCCAATGCCTGGCGTATCTACGCGTTCGTCGACGTCGCAATTAAGGACTAAGCCCGTTTATGTCTGTAA

Full Affymetrix probeset data:

Annotations for 1640151_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime