FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640152_at:

>probe:Drosophila_2:1640152_at:129:507; Interrogation_Position=1245; Antisense; GTGCCATTTGCCGTATTCATTCTTT
>probe:Drosophila_2:1640152_at:570:273; Interrogation_Position=1262; Antisense; CATTCTTTTTCATGCACGGACTGAT
>probe:Drosophila_2:1640152_at:63:63; Interrogation_Position=1285; Antisense; ATGTGCCACCATCTTATCACTGGGT
>probe:Drosophila_2:1640152_at:10:61; Interrogation_Position=1338; Antisense; ATGTTCTTAATCTTTCTCTGCGCCA
>probe:Drosophila_2:1640152_at:337:443; Interrogation_Position=1410; Antisense; GATGACAACTACATGGGCGCCACTG
>probe:Drosophila_2:1640152_at:717:343; Interrogation_Position=1451; Antisense; GAATTTGGGCACTCTTTTCGCGAAC
>probe:Drosophila_2:1640152_at:351:549; Interrogation_Position=1527; Antisense; GGAGGATCTTTTTTCACTATCGTTG
>probe:Drosophila_2:1640152_at:202:193; Interrogation_Position=1553; Antisense; AACTGGGAACACTGTGGCCTACGTA
>probe:Drosophila_2:1640152_at:60:237; Interrogation_Position=1593; Antisense; AATCGCTCTGAACACCACATGGAAG
>probe:Drosophila_2:1640152_at:422:67; Interrogation_Position=1650; Antisense; ATGGCACTCTTTACCATTTTGCTCT
>probe:Drosophila_2:1640152_at:693:691; Interrogation_Position=1667; Antisense; TTTGCTCTGGTCCACAACGTTGGGA
>probe:Drosophila_2:1640152_at:414:13; Interrogation_Position=1691; Antisense; ATTTTTCGCTCGTCGTTCAATGGGC
>probe:Drosophila_2:1640152_at:536:635; Interrogation_Position=1722; Antisense; TCGATTGGGCTATACGTTGTCTACT
>probe:Drosophila_2:1640152_at:420:467; Interrogation_Position=1737; Antisense; GTTGTCTACTTGTTGTTCGTCACTC

Paste this into a BLAST search page for me
GTGCCATTTGCCGTATTCATTCTTTCATTCTTTTTCATGCACGGACTGATATGTGCCACCATCTTATCACTGGGTATGTTCTTAATCTTTCTCTGCGCCAGATGACAACTACATGGGCGCCACTGGAATTTGGGCACTCTTTTCGCGAACGGAGGATCTTTTTTCACTATCGTTGAACTGGGAACACTGTGGCCTACGTAAATCGCTCTGAACACCACATGGAAGATGGCACTCTTTACCATTTTGCTCTTTTGCTCTGGTCCACAACGTTGGGAATTTTTCGCTCGTCGTTCAATGGGCTCGATTGGGCTATACGTTGTCTACTGTTGTCTACTTGTTGTTCGTCACTC

Full Affymetrix probeset data:

Annotations for 1640152_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720