FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640154_at:

>probe:Drosophila_2:1640154_at:163:101; Interrogation_Position=3631; Antisense; AGAGGGCCAGCAGCAATTCACAGGA
>probe:Drosophila_2:1640154_at:8:13; Interrogation_Position=3646; Antisense; ATTCACAGGACACAGCATCGGCGGG
>probe:Drosophila_2:1640154_at:171:391; Interrogation_Position=3719; Antisense; GAAACGCGTTCTACCGAAACACCAG
>probe:Drosophila_2:1640154_at:96:37; Interrogation_Position=3768; Antisense; ATCTTTTCGCCGGATCTAAATCTGC
>probe:Drosophila_2:1640154_at:17:665; Interrogation_Position=3784; Antisense; TAAATCTGCGGCACCACATCGAGAC
>probe:Drosophila_2:1640154_at:623:153; Interrogation_Position=3856; Antisense; ACAGTTGTCGCGGTTACCTGCACAA
>probe:Drosophila_2:1640154_at:396:207; Interrogation_Position=3879; Antisense; AAGCTGGGTGCCACGTTTCATGCCT
>probe:Drosophila_2:1640154_at:660:553; Interrogation_Position=3937; Antisense; GGAGCGCCTTAATTTACTACTCTGA
>probe:Drosophila_2:1640154_at:555:435; Interrogation_Position=3982; Antisense; GAGGCGGAGCCTATTTTGCAACCAT
>probe:Drosophila_2:1640154_at:728:39; Interrogation_Position=4018; Antisense; ATCTGGATCATCTGAATGCCTCGAA
>probe:Drosophila_2:1640154_at:621:317; Interrogation_Position=4048; Antisense; GCCGACCGCATTGTACTTTTATTGT
>probe:Drosophila_2:1640154_at:56:209; Interrogation_Position=4088; Antisense; AAGCTATAACTTACAGGCCGCATCC
>probe:Drosophila_2:1640154_at:374:649; Interrogation_Position=4116; Antisense; TCAGCGGCGCGCATTTGGATCGATG
>probe:Drosophila_2:1640154_at:279:451; Interrogation_Position=4133; Antisense; GATCGATGCCATCATTACCGGAGCC

Paste this into a BLAST search page for me
AGAGGGCCAGCAGCAATTCACAGGAATTCACAGGACACAGCATCGGCGGGGAAACGCGTTCTACCGAAACACCAGATCTTTTCGCCGGATCTAAATCTGCTAAATCTGCGGCACCACATCGAGACACAGTTGTCGCGGTTACCTGCACAAAAGCTGGGTGCCACGTTTCATGCCTGGAGCGCCTTAATTTACTACTCTGAGAGGCGGAGCCTATTTTGCAACCATATCTGGATCATCTGAATGCCTCGAAGCCGACCGCATTGTACTTTTATTGTAAGCTATAACTTACAGGCCGCATCCTCAGCGGCGCGCATTTGGATCGATGGATCGATGCCATCATTACCGGAGCC

Full Affymetrix probeset data:

Annotations for 1640154_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720