FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640155_at:

>probe:Drosophila_2:1640155_at:419:77; Interrogation_Position=103; Antisense; AGGAGGCGCTGATGGTGTTCTCCAC
>probe:Drosophila_2:1640155_at:253:285; Interrogation_Position=111; Antisense; CTGATGGTGTTCTCCACACTGGGCG
>probe:Drosophila_2:1640155_at:291:143; Interrogation_Position=128; Antisense; ACTGGGCGGCGGACTGACAGCCATC
>probe:Drosophila_2:1640155_at:82:557; Interrogation_Position=138; Antisense; GGACTGACAGCCATCGATCCGGTGA
>probe:Drosophila_2:1640155_at:387:447; Interrogation_Position=153; Antisense; GATCCGGTGACCAGCGAAATACGCT
>probe:Drosophila_2:1640155_at:643:395; Interrogation_Position=168; Antisense; GAAATACGCTGGACAATAGCAGATG
>probe:Drosophila_2:1640155_at:450:349; Interrogation_Position=186; Antisense; GCAGATGAGCATTCATATTCGCCTG
>probe:Drosophila_2:1640155_at:601:419; Interrogation_Position=192; Antisense; GAGCATTCATATTCGCCTGATAAGT
>probe:Drosophila_2:1640155_at:424:185; Interrogation_Position=20; Antisense; AAAATCACAACAGGGCGACTCGGCA
>probe:Drosophila_2:1640155_at:288:257; Interrogation_Position=25; Antisense; CACAACAGGGCGACTCGGCAGAAGT
>probe:Drosophila_2:1640155_at:701:145; Interrogation_Position=37; Antisense; ACTCGGCAGAAGTCGTCAGCAGCGG
>probe:Drosophila_2:1640155_at:46:219; Interrogation_Position=46; Antisense; AAGTCGTCAGCAGCGGCGAGGATGA
>probe:Drosophila_2:1640155_at:320:55; Interrogation_Position=67; Antisense; ATGAGAAGACGGACTGCACGGACCT
>probe:Drosophila_2:1640155_at:81:107; Interrogation_Position=70; Antisense; AGAAGACGGACTGCACGGACCTCGC

Paste this into a BLAST search page for me
AGGAGGCGCTGATGGTGTTCTCCACCTGATGGTGTTCTCCACACTGGGCGACTGGGCGGCGGACTGACAGCCATCGGACTGACAGCCATCGATCCGGTGAGATCCGGTGACCAGCGAAATACGCTGAAATACGCTGGACAATAGCAGATGGCAGATGAGCATTCATATTCGCCTGGAGCATTCATATTCGCCTGATAAGTAAAATCACAACAGGGCGACTCGGCACACAACAGGGCGACTCGGCAGAAGTACTCGGCAGAAGTCGTCAGCAGCGGAAGTCGTCAGCAGCGGCGAGGATGAATGAGAAGACGGACTGCACGGACCTAGAAGACGGACTGCACGGACCTCGC

Full Affymetrix probeset data:

Annotations for 1640155_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720