Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640156_at:

>probe:Drosophila_2:1640156_at:79:429; Interrogation_Position=1253; Antisense; GAGATTATACCCACTGCCAAGGGCA
>probe:Drosophila_2:1640156_at:561:593; Interrogation_Position=1286; Antisense; TGGGATGCGCACATAAGCCCGATGT
>probe:Drosophila_2:1640156_at:612:573; Interrogation_Position=1312; Antisense; GGCGGAGTGCATACGTGGCCTACAC
>probe:Drosophila_2:1640156_at:489:75; Interrogation_Position=1359; Antisense; AGGTTCGGGCTCTAATCGAGGGTCA
>probe:Drosophila_2:1640156_at:98:435; Interrogation_Position=1376; Antisense; GAGGGTCAGATCATGCACCACTGGT
>probe:Drosophila_2:1640156_at:548:533; Interrogation_Position=1470; Antisense; GGTGTCAAAGTGTCCTGCAGATCGT
>probe:Drosophila_2:1640156_at:682:269; Interrogation_Position=1501; Antisense; CATATTCAATGCTCCTGTTTACCAG
>probe:Drosophila_2:1640156_at:431:435; Interrogation_Position=1538; Antisense; GAGGTCAGCCTTTTAGGATGCGCCT
>probe:Drosophila_2:1640156_at:202:263; Interrogation_Position=1651; Antisense; CAGCTTCGACGAGTTTTTCAGGGAC
>probe:Drosophila_2:1640156_at:290:559; Interrogation_Position=1702; Antisense; GGAACCAACACCTGGCTGCGATAAG
>probe:Drosophila_2:1640156_at:195:623; Interrogation_Position=1718; Antisense; TGCGATAAGATCTACAAGCCCCTGA
>probe:Drosophila_2:1640156_at:142:597; Interrogation_Position=1740; Antisense; TGATCGAACGATGCTCCCAAATTTG
>probe:Drosophila_2:1640156_at:242:623; Interrogation_Position=1770; Antisense; TGCTGGCCTCCAAATCTAGTGTGTA
>probe:Drosophila_2:1640156_at:116:509; Interrogation_Position=1790; Antisense; GTGTACTTTTTCCACCCAAATGTAT

Paste this into a BLAST search page for me
GAGATTATACCCACTGCCAAGGGCATGGGATGCGCACATAAGCCCGATGTGGCGGAGTGCATACGTGGCCTACACAGGTTCGGGCTCTAATCGAGGGTCAGAGGGTCAGATCATGCACCACTGGTGGTGTCAAAGTGTCCTGCAGATCGTCATATTCAATGCTCCTGTTTACCAGGAGGTCAGCCTTTTAGGATGCGCCTCAGCTTCGACGAGTTTTTCAGGGACGGAACCAACACCTGGCTGCGATAAGTGCGATAAGATCTACAAGCCCCTGATGATCGAACGATGCTCCCAAATTTGTGCTGGCCTCCAAATCTAGTGTGTAGTGTACTTTTTCCACCCAAATGTAT

Full Affymetrix probeset data:

Annotations for 1640156_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime