FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640157_at:

>probe:Drosophila_2:1640157_at:343:145; Interrogation_Position=108; Antisense; ACTTCCGCAGGGAGGTCTGGGACCA
>probe:Drosophila_2:1640157_at:313:641; Interrogation_Position=123; Antisense; TCTGGGACCACTTCAGGGCTCTGGA
>probe:Drosophila_2:1640157_at:432:147; Interrogation_Position=132; Antisense; ACTTCAGGGCTCTGGAGGACTCCAG
>probe:Drosophila_2:1640157_at:320:319; Interrogation_Position=156; Antisense; GCCGCCGCAGGGAATACCTCAGGGA
>probe:Drosophila_2:1640157_at:350:225; Interrogation_Position=199; Antisense; CAAGGACCTCCCCAAGGTGGCAACT
>probe:Drosophila_2:1640157_at:682:519; Interrogation_Position=215; Antisense; GTGGCAACTCATCCTCCTCCGAAGA
>probe:Drosophila_2:1640157_at:561:375; Interrogation_Position=235; Antisense; GAAGACTCTTCCTCCCAGGAGAGCT
>probe:Drosophila_2:1640157_at:87:123; Interrogation_Position=262; Antisense; AGCGAGTCCTCCAGTGAGGCGTCCG
>probe:Drosophila_2:1640157_at:92:439; Interrogation_Position=277; Antisense; GAGGCGTCCGCCTAGAAACTCGATC
>probe:Drosophila_2:1640157_at:23:451; Interrogation_Position=298; Antisense; GATCGCCGAGTCCTTCATGTAAAAA
>probe:Drosophila_2:1640157_at:290:167; Interrogation_Position=32; Antisense; AAATGCGTGTAATCTTCCTCATCGT
>probe:Drosophila_2:1640157_at:165:281; Interrogation_Position=49; Antisense; CTCATCGTTGTGCTCGCCATGGTGG
>probe:Drosophila_2:1640157_at:528:269; Interrogation_Position=66; Antisense; CATGGTGGCTCTGGCTGCTGTCCAA
>probe:Drosophila_2:1640157_at:667:247; Interrogation_Position=88; Antisense; CAAGGACGTCGTCCTCCAGGACTTC

Paste this into a BLAST search page for me
ACTTCCGCAGGGAGGTCTGGGACCATCTGGGACCACTTCAGGGCTCTGGAACTTCAGGGCTCTGGAGGACTCCAGGCCGCCGCAGGGAATACCTCAGGGACAAGGACCTCCCCAAGGTGGCAACTGTGGCAACTCATCCTCCTCCGAAGAGAAGACTCTTCCTCCCAGGAGAGCTAGCGAGTCCTCCAGTGAGGCGTCCGGAGGCGTCCGCCTAGAAACTCGATCGATCGCCGAGTCCTTCATGTAAAAAAAATGCGTGTAATCTTCCTCATCGTCTCATCGTTGTGCTCGCCATGGTGGCATGGTGGCTCTGGCTGCTGTCCAACAAGGACGTCGTCCTCCAGGACTTC

Full Affymetrix probeset data:

Annotations for 1640157_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720