FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640159_at:

>probe:Drosophila_2:1640159_at:208:575; Interrogation_Position=1085; Antisense; GGCGGAGTCATTGTACAAGGCACCA
>probe:Drosophila_2:1640159_at:650:83; Interrogation_Position=1109; Antisense; AGTGGCACAAACCATGTCCTTGGTC
>probe:Drosophila_2:1640159_at:720:523; Interrogation_Position=1138; Antisense; GGGCTCCTACGCAGTATACAGCGGA
>probe:Drosophila_2:1640159_at:613:503; Interrogation_Position=1171; Antisense; GTCCGGACGCTCTTCATGTGATCGA
>probe:Drosophila_2:1640159_at:182:519; Interrogation_Position=1205; Antisense; GTGGGACTATGTTCCGCAGCAGCGA
>probe:Drosophila_2:1640159_at:105:163; Interrogation_Position=1251; Antisense; AAATACCAATTTGCGTTGCCATGTC
>probe:Drosophila_2:1640159_at:658:711; Interrogation_Position=1291; Antisense; TTCAGAGGCCGGTAGCTTCAACAGT
>probe:Drosophila_2:1640159_at:340:425; Interrogation_Position=1320; Antisense; GAGAGCGCCAGTCAGTCGGTTTAAA
>probe:Drosophila_2:1640159_at:278:163; Interrogation_Position=1343; Antisense; AAATTTGTCTTCTTCCATTTCCTGT
>probe:Drosophila_2:1640159_at:496:19; Interrogation_Position=1359; Antisense; ATTTCCTGTACATATGCTCCTGATC
>probe:Drosophila_2:1640159_at:255:449; Interrogation_Position=1380; Antisense; GATCCTGATCCCATTTAGTATAACG
>probe:Drosophila_2:1640159_at:605:467; Interrogation_Position=1461; Antisense; GTTTCTTTTTTCTGTTCTGAGGGCT
>probe:Drosophila_2:1640159_at:24:657; Interrogation_Position=1504; Antisense; TAATCGTTTTTGCTCACACTGCTAA
>probe:Drosophila_2:1640159_at:32:509; Interrogation_Position=1591; Antisense; GTGCTGTCTATATATGTCTGTCCAA

Paste this into a BLAST search page for me
GGCGGAGTCATTGTACAAGGCACCAAGTGGCACAAACCATGTCCTTGGTCGGGCTCCTACGCAGTATACAGCGGAGTCCGGACGCTCTTCATGTGATCGAGTGGGACTATGTTCCGCAGCAGCGAAAATACCAATTTGCGTTGCCATGTCTTCAGAGGCCGGTAGCTTCAACAGTGAGAGCGCCAGTCAGTCGGTTTAAAAAATTTGTCTTCTTCCATTTCCTGTATTTCCTGTACATATGCTCCTGATCGATCCTGATCCCATTTAGTATAACGGTTTCTTTTTTCTGTTCTGAGGGCTTAATCGTTTTTGCTCACACTGCTAAGTGCTGTCTATATATGTCTGTCCAA

Full Affymetrix probeset data:

Annotations for 1640159_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720