Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640160_a_at:

>probe:Drosophila_2:1640160_a_at:507:217; Interrogation_Position=1054; Antisense; AAGTATATAACGTGGCACCTGCCTG
>probe:Drosophila_2:1640160_a_at:606:99; Interrogation_Position=621; Antisense; AGAGGCATTCCATACTGCGCAGGAC
>probe:Drosophila_2:1640160_a_at:448:115; Interrogation_Position=658; Antisense; AGCTTTAGTCAGTGTACTCCGGTAG
>probe:Drosophila_2:1640160_a_at:460:487; Interrogation_Position=679; Antisense; GTAGCTGAATTCGACTGCTCTTTGC
>probe:Drosophila_2:1640160_a_at:714:467; Interrogation_Position=709; Antisense; GTTGCCGAGGACAGTGACTCCAGTG
>probe:Drosophila_2:1640160_a_at:598:627; Interrogation_Position=727; Antisense; TCCAGTGATTGGCTTCTCCGGGTAG
>probe:Drosophila_2:1640160_a_at:589:63; Interrogation_Position=760; Antisense; ATGTGTCCACCATACAGATGCACGT
>probe:Drosophila_2:1640160_a_at:101:181; Interrogation_Position=793; Antisense; AAACACTTTGATCTGGTGCGGTCCA
>probe:Drosophila_2:1640160_a_at:16:509; Interrogation_Position=808; Antisense; GTGCGGTCCATATTTGTTATTCCAA
>probe:Drosophila_2:1640160_a_at:50:137; Interrogation_Position=843; Antisense; ACGAAGGCTCTGCAATGTCTTTCAA
>probe:Drosophila_2:1640160_a_at:601:559; Interrogation_Position=918; Antisense; GGAAATGGCTCCTTTGGATCCTTGC
>probe:Drosophila_2:1640160_a_at:677:545; Interrogation_Position=933; Antisense; GGATCCTTGCTCAGATTCATATGCA
>probe:Drosophila_2:1640160_a_at:52:633; Interrogation_Position=971; Antisense; TCCCGGATTCCACCAACTATGAGAT
>probe:Drosophila_2:1640160_a_at:452:427; Interrogation_Position=991; Antisense; GAGATCGTGGCTTACATCGACAACG

Paste this into a BLAST search page for me
AAGTATATAACGTGGCACCTGCCTGAGAGGCATTCCATACTGCGCAGGACAGCTTTAGTCAGTGTACTCCGGTAGGTAGCTGAATTCGACTGCTCTTTGCGTTGCCGAGGACAGTGACTCCAGTGTCCAGTGATTGGCTTCTCCGGGTAGATGTGTCCACCATACAGATGCACGTAAACACTTTGATCTGGTGCGGTCCAGTGCGGTCCATATTTGTTATTCCAAACGAAGGCTCTGCAATGTCTTTCAAGGAAATGGCTCCTTTGGATCCTTGCGGATCCTTGCTCAGATTCATATGCATCCCGGATTCCACCAACTATGAGATGAGATCGTGGCTTACATCGACAACG

Full Affymetrix probeset data:

Annotations for 1640160_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime