FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640161_at:

>probe:Drosophila_2:1640161_at:246:225; Interrogation_Position=126; Antisense; AAGGATGAGCACTTCCGGCGCAGTT
>probe:Drosophila_2:1640161_at:389:287; Interrogation_Position=141; Antisense; CGGCGCAGTTGATCAGTACACGGTG
>probe:Drosophila_2:1640161_at:374:659; Interrogation_Position=167; Antisense; TAACCGGCGACCGTTCCAAGATCAA
>probe:Drosophila_2:1640161_at:17:455; Interrogation_Position=186; Antisense; GATCAAGGATTTGCTCTGCAGCCGC
>probe:Drosophila_2:1640161_at:591:641; Interrogation_Position=200; Antisense; TCTGCAGCCGCCTTACGGAATGTGG
>probe:Drosophila_2:1640161_at:546:435; Interrogation_Position=235; Antisense; GAGGTGCGTCTGATGTGCCGCAACA
>probe:Drosophila_2:1640161_at:619:61; Interrogation_Position=247; Antisense; ATGTGCCGCAACATCCTGATGGAGA
>probe:Drosophila_2:1640161_at:94:187; Interrogation_Position=280; Antisense; AACAACAGCTTCACCGTAGAGCAGC
>probe:Drosophila_2:1640161_at:517:485; Interrogation_Position=295; Antisense; GTAGAGCAGCTGATCGCCGAGGTAA
>probe:Drosophila_2:1640161_at:86:287; Interrogation_Position=337; Antisense; CTGGTCCCGGATGCCGTCAAAAAGG
>probe:Drosophila_2:1640161_at:163:615; Interrogation_Position=371; Antisense; TGAAGATACGCACCATTCTCACGGA
>probe:Drosophila_2:1640161_at:158:563; Interrogation_Position=405; Antisense; GGAACCCGATGAGCCAGAGGACGAA
>probe:Drosophila_2:1640161_at:18:557; Interrogation_Position=423; Antisense; GGACGAATCCTAACTTTAACTCAGC
>probe:Drosophila_2:1640161_at:572:659; Interrogation_Position=439; Antisense; TAACTCAGCGTCATTGGATTTGTAT

Paste this into a BLAST search page for me
AAGGATGAGCACTTCCGGCGCAGTTCGGCGCAGTTGATCAGTACACGGTGTAACCGGCGACCGTTCCAAGATCAAGATCAAGGATTTGCTCTGCAGCCGCTCTGCAGCCGCCTTACGGAATGTGGGAGGTGCGTCTGATGTGCCGCAACAATGTGCCGCAACATCCTGATGGAGAAACAACAGCTTCACCGTAGAGCAGCGTAGAGCAGCTGATCGCCGAGGTAACTGGTCCCGGATGCCGTCAAAAAGGTGAAGATACGCACCATTCTCACGGAGGAACCCGATGAGCCAGAGGACGAAGGACGAATCCTAACTTTAACTCAGCTAACTCAGCGTCATTGGATTTGTAT

Full Affymetrix probeset data:

Annotations for 1640161_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720