Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640164_at:

>probe:Drosophila_2:1640164_at:536:217; Interrogation_Position=3032; Antisense; AAGTCAATCAGCATATTTGCTCGAT
>probe:Drosophila_2:1640164_at:689:693; Interrogation_Position=3047; Antisense; TTTGCTCGATTGGAGGGAGCATGCC
>probe:Drosophila_2:1640164_at:311:553; Interrogation_Position=3062; Antisense; GGAGCATGCCAAGCGGATAATCGAT
>probe:Drosophila_2:1640164_at:678:29; Interrogation_Position=3078; Antisense; ATAATCGATTCGCAATGTGTTTGAA
>probe:Drosophila_2:1640164_at:506:99; Interrogation_Position=3131; Antisense; AGAGTCATTGTAGCGACGACCCCAG
>probe:Drosophila_2:1640164_at:706:565; Interrogation_Position=3155; Antisense; GGCACACCTACATAGTTCCAACGAA
>probe:Drosophila_2:1640164_at:285:271; Interrogation_Position=3312; Antisense; CATCTTGTTTGGTGAGTGAACTTGC
>probe:Drosophila_2:1640164_at:446:511; Interrogation_Position=3327; Antisense; GTGAACTTGCGACTCGAACTATTGA
>probe:Drosophila_2:1640164_at:442:401; Interrogation_Position=3337; Antisense; GACTCGAACTATTGAACTTTGGGCT
>probe:Drosophila_2:1640164_at:437:727; Interrogation_Position=3355; Antisense; TTGGGCTCAAACAATGAACTTTCCA
>probe:Drosophila_2:1640164_at:135:385; Interrogation_Position=3370; Antisense; GAACTTTCCATACTATTTGCTCCTT
>probe:Drosophila_2:1640164_at:611:687; Interrogation_Position=3383; Antisense; TATTTGCTCCTTACAGACTCTTCAG
>probe:Drosophila_2:1640164_at:397:105; Interrogation_Position=3397; Antisense; AGACTCTTCAGCGTACACTTGGAAA
>probe:Drosophila_2:1640164_at:670:25; Interrogation_Position=3486; Antisense; ATAGCTTAACTTTCTTGGACTTATT

Paste this into a BLAST search page for me
AAGTCAATCAGCATATTTGCTCGATTTTGCTCGATTGGAGGGAGCATGCCGGAGCATGCCAAGCGGATAATCGATATAATCGATTCGCAATGTGTTTGAAAGAGTCATTGTAGCGACGACCCCAGGGCACACCTACATAGTTCCAACGAACATCTTGTTTGGTGAGTGAACTTGCGTGAACTTGCGACTCGAACTATTGAGACTCGAACTATTGAACTTTGGGCTTTGGGCTCAAACAATGAACTTTCCAGAACTTTCCATACTATTTGCTCCTTTATTTGCTCCTTACAGACTCTTCAGAGACTCTTCAGCGTACACTTGGAAAATAGCTTAACTTTCTTGGACTTATT

Full Affymetrix probeset data:

Annotations for 1640164_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime