FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640168_at:

>probe:Drosophila_2:1640168_at:556:711; Interrogation_Position=470; Antisense; TTCTTACCAAGGACTCGCGGCTGTG
>probe:Drosophila_2:1640168_at:696:297; Interrogation_Position=485; Antisense; CGCGGCTGTGCCTAGTAAACGGTAT
>probe:Drosophila_2:1640168_at:596:455; Interrogation_Position=565; Antisense; GATTTCTTCGGATCGGATAGACCTA
>probe:Drosophila_2:1640168_at:269:325; Interrogation_Position=614; Antisense; GCGAGAACTTCTTTTTTGCCGTACT
>probe:Drosophila_2:1640168_at:650:377; Interrogation_Position=649; Antisense; GAAGCCACTGCCCTTAGAATGAATT
>probe:Drosophila_2:1640168_at:396:581; Interrogation_Position=689; Antisense; TGGCCATGATCATTTTACTTCCTGA
>probe:Drosophila_2:1640168_at:609:373; Interrogation_Position=717; Antisense; GAAGTCGAATCTCACGAGCCTCGAA
>probe:Drosophila_2:1640168_at:392:17; Interrogation_Position=757; Antisense; ATTTCCCTAGAGGTAGTGTCATCAG
>probe:Drosophila_2:1640168_at:183:375; Interrogation_Position=807; Antisense; GAAGATTCCTAGCTTTACAGCCGAG
>probe:Drosophila_2:1640168_at:334:719; Interrogation_Position=832; Antisense; TTCCAGCAAGAACTATCCCAGGTTT
>probe:Drosophila_2:1640168_at:660:73; Interrogation_Position=923; Antisense; AGGAAAGCCTTTTTGTCTCCCAGAT
>probe:Drosophila_2:1640168_at:35:633; Interrogation_Position=940; Antisense; TCCCAGATCGTCCACAAAGCATTTA
>probe:Drosophila_2:1640168_at:15:519; Interrogation_Position=979; Antisense; GTGGGCACTGAAGCTGCAGCCGCAA
>probe:Drosophila_2:1640168_at:323:123; Interrogation_Position=996; Antisense; AGCCGCAACGGGTGAGCCTGCAAAA

Paste this into a BLAST search page for me
TTCTTACCAAGGACTCGCGGCTGTGCGCGGCTGTGCCTAGTAAACGGTATGATTTCTTCGGATCGGATAGACCTAGCGAGAACTTCTTTTTTGCCGTACTGAAGCCACTGCCCTTAGAATGAATTTGGCCATGATCATTTTACTTCCTGAGAAGTCGAATCTCACGAGCCTCGAAATTTCCCTAGAGGTAGTGTCATCAGGAAGATTCCTAGCTTTACAGCCGAGTTCCAGCAAGAACTATCCCAGGTTTAGGAAAGCCTTTTTGTCTCCCAGATTCCCAGATCGTCCACAAAGCATTTAGTGGGCACTGAAGCTGCAGCCGCAAAGCCGCAACGGGTGAGCCTGCAAAA

Full Affymetrix probeset data:

Annotations for 1640168_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720