FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640170_at:

>probe:Drosophila_2:1640170_at:470:455; Interrogation_Position=390; Antisense; GATAATCTTTGACTTCATCCCCAAT
>probe:Drosophila_2:1640170_at:77:409; Interrogation_Position=453; Antisense; GACGATCTTGATATCGCTGCTCATG
>probe:Drosophila_2:1640170_at:80:621; Interrogation_Position=470; Antisense; TGCTCATGATCATTGGTGCCCTGAA
>probe:Drosophila_2:1640170_at:497:267; Interrogation_Position=518; Antisense; CATGGGTGGTCCTCGGCATTATGAT
>probe:Drosophila_2:1640170_at:13:681; Interrogation_Position=537; Antisense; TATGATTGCCATCGGTCTGCTGATC
>probe:Drosophila_2:1640170_at:137:605; Interrogation_Position=626; Antisense; TGATCTTCGGCCTAATTGTCTGCGC
>probe:Drosophila_2:1640170_at:625:283; Interrogation_Position=645; Antisense; CTGCGCGATTATGACCTATTGCTGG
>probe:Drosophila_2:1640170_at:168:131; Interrogation_Position=658; Antisense; ACCTATTGCTGGTGCGTGGTCTATA
>probe:Drosophila_2:1640170_at:45:679; Interrogation_Position=681; Antisense; TAGTGAATACGCCAACCTGTCCGAG
>probe:Drosophila_2:1640170_at:682:415; Interrogation_Position=712; Antisense; GAGCGCGGTCGTTACAACAAGCAGC
>probe:Drosophila_2:1640170_at:613:487; Interrogation_Position=738; Antisense; GTACCGTCGCTAGAATCTCCAGGAG
>probe:Drosophila_2:1640170_at:187:239; Interrogation_Position=751; Antisense; AATCTCCAGGAGCACTATTCATCAG
>probe:Drosophila_2:1640170_at:306:47; Interrogation_Position=818; Antisense; ATCCTAGCTTCCTATGTTCGTTTTT
>probe:Drosophila_2:1640170_at:526:331; Interrogation_Position=913; Antisense; GCGGCCCGTGGCATTAAGTGCAATG

Paste this into a BLAST search page for me
GATAATCTTTGACTTCATCCCCAATGACGATCTTGATATCGCTGCTCATGTGCTCATGATCATTGGTGCCCTGAACATGGGTGGTCCTCGGCATTATGATTATGATTGCCATCGGTCTGCTGATCTGATCTTCGGCCTAATTGTCTGCGCCTGCGCGATTATGACCTATTGCTGGACCTATTGCTGGTGCGTGGTCTATATAGTGAATACGCCAACCTGTCCGAGGAGCGCGGTCGTTACAACAAGCAGCGTACCGTCGCTAGAATCTCCAGGAGAATCTCCAGGAGCACTATTCATCAGATCCTAGCTTCCTATGTTCGTTTTTGCGGCCCGTGGCATTAAGTGCAATG

Full Affymetrix probeset data:

Annotations for 1640170_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720