Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640173_at:

>probe:Drosophila_2:1640173_at:365:321; Interrogation_Position=2862; Antisense; GCTGCCGTTGTAGCCGGTTCACGAA
>probe:Drosophila_2:1640173_at:463:295; Interrogation_Position=2883; Antisense; CGAATGGCTGTGACAACGGGTACAA
>probe:Drosophila_2:1640173_at:500:117; Interrogation_Position=2934; Antisense; AGCTCACTTTCTTCATCCGGTTCAT
>probe:Drosophila_2:1640173_at:123:631; Interrogation_Position=2970; Antisense; TCCGGTTCCGGATCATCATCATCGT
>probe:Drosophila_2:1640173_at:417:425; Interrogation_Position=3048; Antisense; GAGATTCAAACTCTAGACTCGCCCA
>probe:Drosophila_2:1640173_at:602:299; Interrogation_Position=3067; Antisense; CGCCCACCGTTTGCATAGATGATGA
>probe:Drosophila_2:1640173_at:416:57; Interrogation_Position=3088; Antisense; ATGAGATTTTGTCGGCCTCATCTTC
>probe:Drosophila_2:1640173_at:475:647; Interrogation_Position=3105; Antisense; TCATCTTCACTACCTCCGTTGGATA
>probe:Drosophila_2:1640173_at:335:729; Interrogation_Position=3123; Antisense; TTGGATACCTCTCCCGTGGAAGTTT
>probe:Drosophila_2:1640173_at:573:673; Interrogation_Position=3199; Antisense; TAGCGGGATCAGCTCCAGTTTCCAG
>probe:Drosophila_2:1640173_at:25:105; Interrogation_Position=3245; Antisense; AGACGAAAGACTCCTATCCCTAATA
>probe:Drosophila_2:1640173_at:219:515; Interrogation_Position=3285; Antisense; GTGTATTTCCCTAAGCTATAAGCGT
>probe:Drosophila_2:1640173_at:637:449; Interrogation_Position=3339; Antisense; GATCTTTCAATTATCCATGTCCGTA
>probe:Drosophila_2:1640173_at:562:269; Interrogation_Position=3354; Antisense; CATGTCCGTAAGAAACTCCAGTTAT

Paste this into a BLAST search page for me
GCTGCCGTTGTAGCCGGTTCACGAACGAATGGCTGTGACAACGGGTACAAAGCTCACTTTCTTCATCCGGTTCATTCCGGTTCCGGATCATCATCATCGTGAGATTCAAACTCTAGACTCGCCCACGCCCACCGTTTGCATAGATGATGAATGAGATTTTGTCGGCCTCATCTTCTCATCTTCACTACCTCCGTTGGATATTGGATACCTCTCCCGTGGAAGTTTTAGCGGGATCAGCTCCAGTTTCCAGAGACGAAAGACTCCTATCCCTAATAGTGTATTTCCCTAAGCTATAAGCGTGATCTTTCAATTATCCATGTCCGTACATGTCCGTAAGAAACTCCAGTTAT

Full Affymetrix probeset data:

Annotations for 1640173_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime