FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640174_at:

>probe:Drosophila_2:1640174_at:154:131; Interrogation_Position=1027; Antisense; ACCGAGTTTCTGGAGTGTCTGTACG
>probe:Drosophila_2:1640174_at:2:145; Interrogation_Position=1055; Antisense; ACTTTGATTTCGAGGGAGCGCGTCT
>probe:Drosophila_2:1640174_at:707:101; Interrogation_Position=1097; Antisense; AGACGGTGATCCTCAACGACTTCTT
>probe:Drosophila_2:1640174_at:254:639; Interrogation_Position=1124; Antisense; TCGTGGCCTGCCTGAATGAGTTCGT
>probe:Drosophila_2:1640174_at:482:549; Interrogation_Position=1149; Antisense; GGAGGATGCCCGCTTGATGATCTTC
>probe:Drosophila_2:1640174_at:376:59; Interrogation_Position=1165; Antisense; ATGATCTTCGAGACATTCTGCCGCA
>probe:Drosophila_2:1640174_at:523:607; Interrogation_Position=1251; Antisense; TGAGTGCTGGATCGTCAACCTTATC
>probe:Drosophila_2:1640174_at:519:49; Interrogation_Position=1280; Antisense; ATGCCCGTCTGAATGCCAAGATCGA
>probe:Drosophila_2:1640174_at:339:725; Interrogation_Position=1342; Antisense; TTGAGTCCCTATCAGCAGCTGGTGG
>probe:Drosophila_2:1640174_at:131:553; Interrogation_Position=1365; Antisense; GGAGAAGATCGACTCGCTGTCCATG
>probe:Drosophila_2:1640174_at:432:577; Interrogation_Position=1452; Antisense; GGCCGACTCCTGGAAGTACTACTAG
>probe:Drosophila_2:1640174_at:282:183; Interrogation_Position=1525; Antisense; AAAACCGATGATTGCGCGCAGTCGA
>probe:Drosophila_2:1640174_at:508:13; Interrogation_Position=1558; Antisense; ATTAACATCTTACTCATTCGCTCAA
>probe:Drosophila_2:1640174_at:267:447; Interrogation_Position=990; Antisense; GATCCAACAGGAGTCGTACACGTAC

Paste this into a BLAST search page for me
ACCGAGTTTCTGGAGTGTCTGTACGACTTTGATTTCGAGGGAGCGCGTCTAGACGGTGATCCTCAACGACTTCTTTCGTGGCCTGCCTGAATGAGTTCGTGGAGGATGCCCGCTTGATGATCTTCATGATCTTCGAGACATTCTGCCGCATGAGTGCTGGATCGTCAACCTTATCATGCCCGTCTGAATGCCAAGATCGATTGAGTCCCTATCAGCAGCTGGTGGGGAGAAGATCGACTCGCTGTCCATGGGCCGACTCCTGGAAGTACTACTAGAAAACCGATGATTGCGCGCAGTCGAATTAACATCTTACTCATTCGCTCAAGATCCAACAGGAGTCGTACACGTAC

Full Affymetrix probeset data:

Annotations for 1640174_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720