FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640177_at:

>probe:Drosophila_2:1640177_at:708:345; Interrogation_Position=1009; Antisense; GCATCATCTGTTCCCAGCAAACAAA
>probe:Drosophila_2:1640177_at:454:229; Interrogation_Position=1032; Antisense; AATGGTATTTTCAATCCCGCCAAAG
>probe:Drosophila_2:1640177_at:585:417; Interrogation_Position=1056; Antisense; GAGCTGATAGCTCGCCTCAAGACAA
>probe:Drosophila_2:1640177_at:648:207; Interrogation_Position=1156; Antisense; AAGCTCAGGAGATTTCTTCGGATGA
>probe:Drosophila_2:1640177_at:268:233; Interrogation_Position=1260; Antisense; AATCCATTTTACAGCACATTTGCCG
>probe:Drosophila_2:1640177_at:2:191; Interrogation_Position=1302; Antisense; AAGTAAGGATTGTACCACCGATAGG
>probe:Drosophila_2:1640177_at:588:277; Interrogation_Position=1351; Antisense; CTTTGCCCCAAAGAGAATTGCTGAT
>probe:Drosophila_2:1640177_at:155:145; Interrogation_Position=844; Antisense; ACTCCGATGGCGATGATACCAAGTA
>probe:Drosophila_2:1640177_at:437:107; Interrogation_Position=887; Antisense; AGAAACACTGCCTTTCAAGTGCCAC
>probe:Drosophila_2:1640177_at:694:219; Interrogation_Position=903; Antisense; AAGTGCCACATCTGCCGACAGAGTT
>probe:Drosophila_2:1640177_at:597:427; Interrogation_Position=923; Antisense; GAGTTTTGTCAATCCCGTGGTAACA
>probe:Drosophila_2:1640177_at:494:17; Interrogation_Position=961; Antisense; ATTTCTGTGAAAAGTGCGCCTTGGC
>probe:Drosophila_2:1640177_at:272:625; Interrogation_Position=975; Antisense; TGCGCCTTGGCCCAGTACAAAAAGT
>probe:Drosophila_2:1640177_at:365:171; Interrogation_Position=995; Antisense; AAAGTCACAGCGCTGCATCATCTGT

Paste this into a BLAST search page for me
GCATCATCTGTTCCCAGCAAACAAAAATGGTATTTTCAATCCCGCCAAAGGAGCTGATAGCTCGCCTCAAGACAAAAGCTCAGGAGATTTCTTCGGATGAAATCCATTTTACAGCACATTTGCCGAAGTAAGGATTGTACCACCGATAGGCTTTGCCCCAAAGAGAATTGCTGATACTCCGATGGCGATGATACCAAGTAAGAAACACTGCCTTTCAAGTGCCACAAGTGCCACATCTGCCGACAGAGTTGAGTTTTGTCAATCCCGTGGTAACAATTTCTGTGAAAAGTGCGCCTTGGCTGCGCCTTGGCCCAGTACAAAAAGTAAAGTCACAGCGCTGCATCATCTGT

Full Affymetrix probeset data:

Annotations for 1640177_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720