FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640178_at:

>probe:Drosophila_2:1640178_at:424:417; Interrogation_Position=1046; Antisense; GAGCAGCCCAATCTATAGTTTTAAG
>probe:Drosophila_2:1640178_at:392:689; Interrogation_Position=1065; Antisense; TTTAAGCCTACCATATGGACACCCC
>probe:Drosophila_2:1640178_at:506:299; Interrogation_Position=1126; Antisense; CGCGCCCAGGAGCAGATCTTTGAAA
>probe:Drosophila_2:1640178_at:334:393; Interrogation_Position=1147; Antisense; GAAAGCATCGGACATCAAATCAATC
>probe:Drosophila_2:1640178_at:524:251; Interrogation_Position=1171; Antisense; CAACCACTTGCGCATTTATCCATTA
>probe:Drosophila_2:1640178_at:568:245; Interrogation_Position=1195; Antisense; AATTGTTAGTTTTGCCAATGCGGCG
>probe:Drosophila_2:1640178_at:434:311; Interrogation_Position=1209; Antisense; CCAATGCGGCGGATGTTAAGATAAC
>probe:Drosophila_2:1640178_at:111:167; Interrogation_Position=1269; Antisense; AAATGCGCTTTATCAAGTTCGACGA
>probe:Drosophila_2:1640178_at:223:261; Interrogation_Position=798; Antisense; CACCGATGTCAAGCGTCGCGTGGGT
>probe:Drosophila_2:1640178_at:466:519; Interrogation_Position=821; Antisense; GTGGTACTGCACCAACTTCATTCAA
>probe:Drosophila_2:1640178_at:648:275; Interrogation_Position=836; Antisense; CTTCATTCAAGCGTGGTGGTGGCCA
>probe:Drosophila_2:1640178_at:319:663; Interrogation_Position=886; Antisense; TTCAAACGTCCGGTCGGTGGCAAGC
>probe:Drosophila_2:1640178_at:83:285; Interrogation_Position=953; Antisense; CTGCTGAGGAGCTGGACGCCGAACT
>probe:Drosophila_2:1640178_at:493:319; Interrogation_Position=970; Antisense; GCCGAACTGGACTCATACATCAACG

Paste this into a BLAST search page for me
GAGCAGCCCAATCTATAGTTTTAAGTTTAAGCCTACCATATGGACACCCCCGCGCCCAGGAGCAGATCTTTGAAAGAAAGCATCGGACATCAAATCAATCCAACCACTTGCGCATTTATCCATTAAATTGTTAGTTTTGCCAATGCGGCGCCAATGCGGCGGATGTTAAGATAACAAATGCGCTTTATCAAGTTCGACGACACCGATGTCAAGCGTCGCGTGGGTGTGGTACTGCACCAACTTCATTCAACTTCATTCAAGCGTGGTGGTGGCCATTCAAACGTCCGGTCGGTGGCAAGCCTGCTGAGGAGCTGGACGCCGAACTGCCGAACTGGACTCATACATCAACG

Full Affymetrix probeset data:

Annotations for 1640178_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720