FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640180_at:

>probe:Drosophila_2:1640180_at:307:489; Interrogation_Position=1222; Antisense; GTACATGGGCCTGAGCAATCTGAAT
>probe:Drosophila_2:1640180_at:219:237; Interrogation_Position=1238; Antisense; AATCTGAATGGGATCTTTGGCGCGG
>probe:Drosophila_2:1640180_at:120:41; Interrogation_Position=1288; Antisense; ATCGGCCGGCTATCCGCAGAATCTA
>probe:Drosophila_2:1640180_at:268:265; Interrogation_Position=1304; Antisense; CAGAATCTATCGCTGCACGCAGGAC
>probe:Drosophila_2:1640180_at:629:73; Interrogation_Position=1324; Antisense; AGGACTCTCTGCGATGAGCCAAGTT
>probe:Drosophila_2:1640180_at:59:113; Interrogation_Position=1361; Antisense; AGCAACAGCAGTCCGCGCGAGAGTC
>probe:Drosophila_2:1640180_at:241:427; Interrogation_Position=1379; Antisense; GAGAGTCCCAAGCTAGTGCCTCATC
>probe:Drosophila_2:1640180_at:596:659; Interrogation_Position=1458; Antisense; TAACGGGCGGACTGATCTCGACGGC
>probe:Drosophila_2:1640180_at:604:437; Interrogation_Position=1556; Antisense; GAGGACTGAACGCTGTTCCGTGATA
>probe:Drosophila_2:1640180_at:666:701; Interrogation_Position=1635; Antisense; TTATTCATGGTCACATAGCCCACGC
>probe:Drosophila_2:1640180_at:110:675; Interrogation_Position=1650; Antisense; TAGCCCACGCACTGTAAGATATTTG
>probe:Drosophila_2:1640180_at:713:19; Interrogation_Position=1670; Antisense; ATTTGCAGCTTTGTCGATTGCCAAA
>probe:Drosophila_2:1640180_at:314:483; Interrogation_Position=1726; Antisense; GTATCTGTAAGCGATCTTCGAGCGA
>probe:Drosophila_2:1640180_at:321:275; Interrogation_Position=1741; Antisense; CTTCGAGCGAACATTTTGGTAGTCT

Paste this into a BLAST search page for me
GTACATGGGCCTGAGCAATCTGAATAATCTGAATGGGATCTTTGGCGCGGATCGGCCGGCTATCCGCAGAATCTACAGAATCTATCGCTGCACGCAGGACAGGACTCTCTGCGATGAGCCAAGTTAGCAACAGCAGTCCGCGCGAGAGTCGAGAGTCCCAAGCTAGTGCCTCATCTAACGGGCGGACTGATCTCGACGGCGAGGACTGAACGCTGTTCCGTGATATTATTCATGGTCACATAGCCCACGCTAGCCCACGCACTGTAAGATATTTGATTTGCAGCTTTGTCGATTGCCAAAGTATCTGTAAGCGATCTTCGAGCGACTTCGAGCGAACATTTTGGTAGTCT

Full Affymetrix probeset data:

Annotations for 1640180_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720