Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640181_at:

>probe:Drosophila_2:1640181_at:577:59; Interrogation_Position=13; Antisense; ATGTTCAAATTGTTCGTTCTCGCTG
>probe:Drosophila_2:1640181_at:123:305; Interrogation_Position=131; Antisense; CCGTTCTGGCCAAAGTGGGTGCTGT
>probe:Drosophila_2:1640181_at:717:507; Interrogation_Position=149; Antisense; GTGCTGTTGTGAAGAGCGTGCCCAC
>probe:Drosophila_2:1640181_at:579:595; Interrogation_Position=156; Antisense; TGTGAAGAGCGTGCCCACCGCCGTG
>probe:Drosophila_2:1640181_at:727:161; Interrogation_Position=19; Antisense; AAATTGTTCGTTCTCGCTGCTCTTT
>probe:Drosophila_2:1640181_at:272:517; Interrogation_Position=229; Antisense; GTGGTGGCTCCCGTGGTCAAGACCA
>probe:Drosophila_2:1640181_at:369:519; Interrogation_Position=241; Antisense; GTGGTCAAGACCACCGCTGTCCACT
>probe:Drosophila_2:1640181_at:307:299; Interrogation_Position=282; Antisense; CGCCGCACCCATTGTGAAGACTTTG
>probe:Drosophila_2:1640181_at:475:3; Interrogation_Position=292; Antisense; ATTGTGAAGACTTTGGCTCCCGTCG
>probe:Drosophila_2:1640181_at:153:613; Interrogation_Position=296; Antisense; TGAAGACTTTGGCTCCCGTCGCCTA
>probe:Drosophila_2:1640181_at:594:635; Interrogation_Position=32; Antisense; TCGCTGCTCTTTTGGCCGTGGCCGC
>probe:Drosophila_2:1640181_at:84:639; Interrogation_Position=361; Antisense; TCGTATGCCGCTCCTCTGACCTATT
>probe:Drosophila_2:1640181_at:571:609; Interrogation_Position=377; Antisense; TGACCTATTCCGCACCGGTGGCCTA
>probe:Drosophila_2:1640181_at:406:413; Interrogation_Position=456; Antisense; GACCTACGCCGCTGGCTCCTGGTAA

Paste this into a BLAST search page for me
ATGTTCAAATTGTTCGTTCTCGCTGCCGTTCTGGCCAAAGTGGGTGCTGTGTGCTGTTGTGAAGAGCGTGCCCACTGTGAAGAGCGTGCCCACCGCCGTGAAATTGTTCGTTCTCGCTGCTCTTTGTGGTGGCTCCCGTGGTCAAGACCAGTGGTCAAGACCACCGCTGTCCACTCGCCGCACCCATTGTGAAGACTTTGATTGTGAAGACTTTGGCTCCCGTCGTGAAGACTTTGGCTCCCGTCGCCTATCGCTGCTCTTTTGGCCGTGGCCGCTCGTATGCCGCTCCTCTGACCTATTTGACCTATTCCGCACCGGTGGCCTAGACCTACGCCGCTGGCTCCTGGTAA

Full Affymetrix probeset data:

Annotations for 1640181_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime