Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640184_at:

>probe:Drosophila_2:1640184_at:569:413; Interrogation_Position=1457; Antisense; GACCATTTCGCAGGCAGACCTGGTG
>probe:Drosophila_2:1640184_at:614:633; Interrogation_Position=1515; Antisense; TCCCAGCCACACGTGACTATGGAGA
>probe:Drosophila_2:1640184_at:468:681; Interrogation_Position=1532; Antisense; TATGGAGAAGCTACCGGACCGCTAC
>probe:Drosophila_2:1640184_at:330:555; Interrogation_Position=1547; Antisense; GGACCGCTACCACATCGAGGTGAAG
>probe:Drosophila_2:1640184_at:584:619; Interrogation_Position=1645; Antisense; TGCTCAACGAACTCTCATTGCACAG
>probe:Drosophila_2:1640184_at:190:121; Interrogation_Position=1721; Antisense; AGCGGGAAGCATCACACAGGGCTAT
>probe:Drosophila_2:1640184_at:447:341; Interrogation_Position=1741; Antisense; GCTATGCCCCTGGACGAGGTGGATC
>probe:Drosophila_2:1640184_at:44:115; Interrogation_Position=1864; Antisense; AGCAGATGCATTACACGCGGCGATT
>probe:Drosophila_2:1640184_at:414:135; Interrogation_Position=1878; Antisense; ACGCGGCGATTGTACTAGCCTCTAA
>probe:Drosophila_2:1640184_at:730:597; Interrogation_Position=1917; Antisense; TGTCGCTACGGAACTCGCTAACTGA
>probe:Drosophila_2:1640184_at:611:401; Interrogation_Position=1962; Antisense; GACATTACAACACTGACTACGCTTC
>probe:Drosophila_2:1640184_at:382:671; Interrogation_Position=1979; Antisense; TACGCTTCCCACGTGAAGTCGGATA
>probe:Drosophila_2:1640184_at:638:663; Interrogation_Position=2011; Antisense; TAAAGCACACAACTATGGCGTCCCT
>probe:Drosophila_2:1640184_at:322:681; Interrogation_Position=2024; Antisense; TATGGCGTCCCTATTTTCCAATCGA

Paste this into a BLAST search page for me
GACCATTTCGCAGGCAGACCTGGTGTCCCAGCCACACGTGACTATGGAGATATGGAGAAGCTACCGGACCGCTACGGACCGCTACCACATCGAGGTGAAGTGCTCAACGAACTCTCATTGCACAGAGCGGGAAGCATCACACAGGGCTATGCTATGCCCCTGGACGAGGTGGATCAGCAGATGCATTACACGCGGCGATTACGCGGCGATTGTACTAGCCTCTAATGTCGCTACGGAACTCGCTAACTGAGACATTACAACACTGACTACGCTTCTACGCTTCCCACGTGAAGTCGGATATAAAGCACACAACTATGGCGTCCCTTATGGCGTCCCTATTTTCCAATCGA

Full Affymetrix probeset data:

Annotations for 1640184_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime