FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640185_at:

>probe:Drosophila_2:1640185_at:533:713; Interrogation_Position=1060; Antisense; TTCAGTGGCTTCCTGCTCTATGACA
>probe:Drosophila_2:1640185_at:609:619; Interrogation_Position=1073; Antisense; TGCTCTATGACACTCAGCGCATGGT
>probe:Drosophila_2:1640185_at:620:435; Interrogation_Position=1108; Antisense; GAGGTCTATCCCCAGTACAGCTACA
>probe:Drosophila_2:1640185_at:672:237; Interrogation_Position=1146; Antisense; AATCAACGCCTCAATGTCGATCTAC
>probe:Drosophila_2:1640185_at:322:631; Interrogation_Position=1162; Antisense; TCGATCTACATGGACGTGCTGAACA
>probe:Drosophila_2:1640185_at:276:335; Interrogation_Position=1179; Antisense; GCTGAACATATTCATCCGCATCGTT
>probe:Drosophila_2:1640185_at:7:47; Interrogation_Position=1192; Antisense; ATCCGCATCGTTACCATTCTGAGTG
>probe:Drosophila_2:1640185_at:244:221; Interrogation_Position=1231; Antisense; AAGTGAGCACTGGAGACGAACATGT
>probe:Drosophila_2:1640185_at:232:337; Interrogation_Position=734; Antisense; GCTCGATTGAGTACCAGCCGGGTCT
>probe:Drosophila_2:1640185_at:500:123; Interrogation_Position=749; Antisense; AGCCGGGTCTGGGAGCCAAGCATCT
>probe:Drosophila_2:1640185_at:415:513; Interrogation_Position=808; Antisense; GTGATCGCACCCATTTGCTTCATGG
>probe:Drosophila_2:1640185_at:354:267; Interrogation_Position=828; Antisense; CATGGGCGGACCGATTTTGACGCGC
>probe:Drosophila_2:1640185_at:230:329; Interrogation_Position=901; Antisense; GCGTGTGCACCCAGCGATAAGTTCC
>probe:Drosophila_2:1640185_at:634:453; Interrogation_Position=916; Antisense; GATAAGTTCCTCTACATGGGCGGCC

Paste this into a BLAST search page for me
TTCAGTGGCTTCCTGCTCTATGACATGCTCTATGACACTCAGCGCATGGTGAGGTCTATCCCCAGTACAGCTACAAATCAACGCCTCAATGTCGATCTACTCGATCTACATGGACGTGCTGAACAGCTGAACATATTCATCCGCATCGTTATCCGCATCGTTACCATTCTGAGTGAAGTGAGCACTGGAGACGAACATGTGCTCGATTGAGTACCAGCCGGGTCTAGCCGGGTCTGGGAGCCAAGCATCTGTGATCGCACCCATTTGCTTCATGGCATGGGCGGACCGATTTTGACGCGCGCGTGTGCACCCAGCGATAAGTTCCGATAAGTTCCTCTACATGGGCGGCC

Full Affymetrix probeset data:

Annotations for 1640185_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720