Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640189_at:

>probe:Drosophila_2:1640189_at:355:103; Interrogation_Position=1082; Antisense; AGACCGACGAGGCTGGCTGCATTAA
>probe:Drosophila_2:1640189_at:390:345; Interrogation_Position=1100; Antisense; GCATTAATGCGCCAGAACCAGAACC
>probe:Drosophila_2:1640189_at:110:109; Interrogation_Position=1119; Antisense; AGAACCAGAGCCTGAACCAGAGCCA
>probe:Drosophila_2:1640189_at:48:103; Interrogation_Position=1137; Antisense; AGAGCCAGAGCCTGAACCGGAATCT
>probe:Drosophila_2:1640189_at:359:235; Interrogation_Position=1157; Antisense; AATCTGAACCAGAGGCCGAACCCGA
>probe:Drosophila_2:1640189_at:661:607; Interrogation_Position=1191; Antisense; TGAGCCTGAGCCTGAGTCTGAACCA
>probe:Drosophila_2:1640189_at:635:217; Interrogation_Position=1234; Antisense; CAAGTCCCGGAAGCCAATGGTAAGT
>probe:Drosophila_2:1640189_at:80:241; Interrogation_Position=675; Antisense; AATAGAGCTGCCCACTTCGGTCAAC
>probe:Drosophila_2:1640189_at:533:481; Interrogation_Position=743; Antisense; GTATCGAAAACTTGAGCGCCGCTAC
>probe:Drosophila_2:1640189_at:656:67; Interrogation_Position=770; Antisense; ATGGCGTATTTTCCTTCACTGAATC
>probe:Drosophila_2:1640189_at:54:43; Interrogation_Position=817; Antisense; ATCGATGTTACATTGCCCCAGGAAG
>probe:Drosophila_2:1640189_at:147:435; Interrogation_Position=847; Antisense; GAGGGCTCTGGTAGCGATGACTCCA
>probe:Drosophila_2:1640189_at:138:19; Interrogation_Position=919; Antisense; ATTTGCGATGAAATGCGCTGCGATA
>probe:Drosophila_2:1640189_at:591:101; Interrogation_Position=945; Antisense; AGAGATCCAATGTCCCGATGGCGAG

Paste this into a BLAST search page for me
AGACCGACGAGGCTGGCTGCATTAAGCATTAATGCGCCAGAACCAGAACCAGAACCAGAGCCTGAACCAGAGCCAAGAGCCAGAGCCTGAACCGGAATCTAATCTGAACCAGAGGCCGAACCCGATGAGCCTGAGCCTGAGTCTGAACCACAAGTCCCGGAAGCCAATGGTAAGTAATAGAGCTGCCCACTTCGGTCAACGTATCGAAAACTTGAGCGCCGCTACATGGCGTATTTTCCTTCACTGAATCATCGATGTTACATTGCCCCAGGAAGGAGGGCTCTGGTAGCGATGACTCCAATTTGCGATGAAATGCGCTGCGATAAGAGATCCAATGTCCCGATGGCGAG

Full Affymetrix probeset data:

Annotations for 1640189_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime