Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640190_at:

>probe:Drosophila_2:1640190_at:645:333; Interrogation_Position=1817; Antisense; GCTGTGGCCATGTTCATGATCACGA
>probe:Drosophila_2:1640190_at:180:137; Interrogation_Position=1838; Antisense; ACGATGACCTATCCGGCCGAGTTTA
>probe:Drosophila_2:1640190_at:602:427; Interrogation_Position=1856; Antisense; GAGTTTAACACGGAGAACCTGCTGT
>probe:Drosophila_2:1640190_at:96:203; Interrogation_Position=1871; Antisense; AACCTGCTGTTCATGCTCTTCTGGG
>probe:Drosophila_2:1640190_at:542:231; Interrogation_Position=1900; Antisense; AATGATCGCTGTCAGTGCCACGGGC
>probe:Drosophila_2:1640190_at:326:147; Interrogation_Position=1932; Antisense; ACTACGGCGTCGAGTTCGTGCAGTG
>probe:Drosophila_2:1640190_at:339:275; Interrogation_Position=1981; Antisense; CTTTCGAGACCCATGACGTTAGTGT
>probe:Drosophila_2:1640190_at:428:137; Interrogation_Position=1996; Antisense; ACGTTAGTGTCGTCTAGCAGAGTCA
>probe:Drosophila_2:1640190_at:554:561; Interrogation_Position=2024; Antisense; GGAACTACCTCTGCAGCTAAACTGT
>probe:Drosophila_2:1640190_at:678:661; Interrogation_Position=2041; Antisense; TAAACTGTCCCATTGCTCCGAGAAA
>probe:Drosophila_2:1640190_at:123:601; Interrogation_Position=2086; Antisense; TGTAATCGATTCGACTTCCTCTCAA
>probe:Drosophila_2:1640190_at:384:403; Interrogation_Position=2098; Antisense; GACTTCCTCTCAATTTCTGTTTTGT
>probe:Drosophila_2:1640190_at:571:451; Interrogation_Position=2200; Antisense; GATCACTTACACTTAGGCGAGCTTC
>probe:Drosophila_2:1640190_at:191:577; Interrogation_Position=2283; Antisense; GGCGCCGCTTATTAACTGCGATTAA

Paste this into a BLAST search page for me
GCTGTGGCCATGTTCATGATCACGAACGATGACCTATCCGGCCGAGTTTAGAGTTTAACACGGAGAACCTGCTGTAACCTGCTGTTCATGCTCTTCTGGGAATGATCGCTGTCAGTGCCACGGGCACTACGGCGTCGAGTTCGTGCAGTGCTTTCGAGACCCATGACGTTAGTGTACGTTAGTGTCGTCTAGCAGAGTCAGGAACTACCTCTGCAGCTAAACTGTTAAACTGTCCCATTGCTCCGAGAAATGTAATCGATTCGACTTCCTCTCAAGACTTCCTCTCAATTTCTGTTTTGTGATCACTTACACTTAGGCGAGCTTCGGCGCCGCTTATTAACTGCGATTAA

Full Affymetrix probeset data:

Annotations for 1640190_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime