FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640192_at:

>probe:Drosophila_2:1640192_at:344:201; Interrogation_Position=1699; Antisense; AACCCATCGTCACCAGAGGATCAGG
>probe:Drosophila_2:1640192_at:565:453; Interrogation_Position=1717; Antisense; GATCAGGACGCGGAATCCAACCCAA
>probe:Drosophila_2:1640192_at:580:233; Interrogation_Position=1740; Antisense; AATGCCCTCGCCCATGGAATCGATA
>probe:Drosophila_2:1640192_at:509:43; Interrogation_Position=1758; Antisense; ATCGATAGTGGCCATGTTCCTAATG
>probe:Drosophila_2:1640192_at:422:327; Interrogation_Position=1813; Antisense; GCGATGGTGTCTACGCAGCACGAAT
>probe:Drosophila_2:1640192_at:539:47; Interrogation_Position=1849; Antisense; ATCCTCTTCTTTCTGTTCATGGTGA
>probe:Drosophila_2:1640192_at:582:605; Interrogation_Position=1871; Antisense; TGATCGTGAGTGTTCTGCTGGTGAA
>probe:Drosophila_2:1640192_at:655:447; Interrogation_Position=1941; Antisense; GATCCGAAACGAGTGGCAGCGCCAA
>probe:Drosophila_2:1640192_at:94:79; Interrogation_Position=1972; Antisense; AGGATCGTCCTCGTCGTGGAGCGAA
>probe:Drosophila_2:1640192_at:104:351; Interrogation_Position=2031; Antisense; GCAGTACAGTCAGTCGATGTCGGAT
>probe:Drosophila_2:1640192_at:240:143; Interrogation_Position=2067; Antisense; ACTGGTCCTCCGGTTGAATATGACT
>probe:Drosophila_2:1640192_at:499:55; Interrogation_Position=2128; Antisense; ATGAAGCGCATCCATCAACGGTTCG
>probe:Drosophila_2:1640192_at:391:321; Interrogation_Position=2183; Antisense; GCGCCCTTCGACGTCAACAGGAGTA
>probe:Drosophila_2:1640192_at:706:89; Interrogation_Position=2204; Antisense; AGTACGAGAAGTTCTTCGGCACCGC

Paste this into a BLAST search page for me
AACCCATCGTCACCAGAGGATCAGGGATCAGGACGCGGAATCCAACCCAAAATGCCCTCGCCCATGGAATCGATAATCGATAGTGGCCATGTTCCTAATGGCGATGGTGTCTACGCAGCACGAATATCCTCTTCTTTCTGTTCATGGTGATGATCGTGAGTGTTCTGCTGGTGAAGATCCGAAACGAGTGGCAGCGCCAAAGGATCGTCCTCGTCGTGGAGCGAAGCAGTACAGTCAGTCGATGTCGGATACTGGTCCTCCGGTTGAATATGACTATGAAGCGCATCCATCAACGGTTCGGCGCCCTTCGACGTCAACAGGAGTAAGTACGAGAAGTTCTTCGGCACCGC

Full Affymetrix probeset data:

Annotations for 1640192_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720