FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640196_at:

>probe:Drosophila_2:1640196_at:641:61; Interrogation_Position=2450; Antisense; ATGTCTACCACATCAAGGTGCGTGA
>probe:Drosophila_2:1640196_at:723:63; Interrogation_Position=2476; Antisense; ATGGCAACCGGCAAGGACCTAGGCT
>probe:Drosophila_2:1640196_at:471:225; Interrogation_Position=2488; Antisense; AAGGACCTAGGCTGCATTCTGGGAA
>probe:Drosophila_2:1640196_at:255:83; Interrogation_Position=2518; Antisense; AGGGCCATCAACCAAGCTATCGGGA
>probe:Drosophila_2:1640196_at:615:9; Interrogation_Position=2560; Antisense; ATTCCCACGTTCTGTGAGCTGGACA
>probe:Drosophila_2:1640196_at:32:189; Interrogation_Position=2587; Antisense; AACAGGCAGTACGATCCCAGGGACT
>probe:Drosophila_2:1640196_at:192:563; Interrogation_Position=2618; Antisense; TGGACGAACTTTGCCGTCGGCAGTG
>probe:Drosophila_2:1640196_at:340:223; Interrogation_Position=2682; Antisense; AAGGGTCGTCGAATTTTGCACTCGT
>probe:Drosophila_2:1640196_at:375:193; Interrogation_Position=2780; Antisense; AACTAACTGGCCGAGGAGCGGTCAC
>probe:Drosophila_2:1640196_at:696:415; Interrogation_Position=2795; Antisense; GAGCGGTCACTAGTAGCTTGGTTGA
>probe:Drosophila_2:1640196_at:43:107; Interrogation_Position=2855; Antisense; AGACATCCAGTTTATTCCTACGCAT
>probe:Drosophila_2:1640196_at:466:17; Interrogation_Position=2881; Antisense; ATTTCTGGCCAGTGTAATGACGTTC
>probe:Drosophila_2:1640196_at:445:529; Interrogation_Position=2932; Antisense; GGGTTCGATAGCCATAATGCACTTT
>probe:Drosophila_2:1640196_at:693:615; Interrogation_Position=2949; Antisense; TGCACTTTAGCTTTCATACCATTTA

Paste this into a BLAST search page for me
ATGTCTACCACATCAAGGTGCGTGAATGGCAACCGGCAAGGACCTAGGCTAAGGACCTAGGCTGCATTCTGGGAAAGGGCCATCAACCAAGCTATCGGGAATTCCCACGTTCTGTGAGCTGGACAAACAGGCAGTACGATCCCAGGGACTTGGACGAACTTTGCCGTCGGCAGTGAAGGGTCGTCGAATTTTGCACTCGTAACTAACTGGCCGAGGAGCGGTCACGAGCGGTCACTAGTAGCTTGGTTGAAGACATCCAGTTTATTCCTACGCATATTTCTGGCCAGTGTAATGACGTTCGGGTTCGATAGCCATAATGCACTTTTGCACTTTAGCTTTCATACCATTTA

Full Affymetrix probeset data:

Annotations for 1640196_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720